SimpleChIP ® Universal qPCR Master Mix from Cell Signaling Technology

Product Specs
ItemSimpleChIP ® Universal qPCR Master Mix
CompanyCell Signaling Technology
Price $81.00 Inquire
Catalog Number88989P
Quantity1 ml
ApplicationsChIP, C&R
Research AreaChromatin Regulation / Nuclear Function
Source/Expression SystemE. coli

Add to Compare List

Cell Signaling Technology

3 Trask Lane

Danvers, Massachusetts 01923

United States

Phone: 877-616-CELL
Phone: 978-867-2388
Fax: 866-432-6112
Fax: 978-867-2488

Company Profile

Website: http://www.cellsignal.com/

Website: Technical Support

(1) The paraspeckle protein NONO potentiates the antiviral innate immune response through chromatin regulationbioRxivJuly 14, 2026Adam Hage, Mikhaila Janes, Byron Shue, Tovah E. Markowitz, Suhyeon Yoon, Jeffrey G. Shannon, Paul A. Beare, Rebecca M. Broeckel, Justin B. Lack, Craig Martens, et al.,Cell Signaling Technology,Cat# 56383 SimpleChIP Universal qPCR Master Mix,Cell Signaling Technology,Cat# 88989 ATAC-seq Kit,Active Motif,Cat# 53150 NEBNext Ultra II DNA Library Prep Kit,New England Biolabs,Cat#

(2) The Protective Mechanism of Continuous Theta Burst Stimulation in the Acute Phase of Stroke Through Modulation of the Calcineurin/AKT/FOXO1 Signaling PathwayCNS Neurosci TherJuly 8, 2026Pengkun Yang, Haocheng Qin, Bao Zhou, Shenyi Kuang, Meixi Liu, Yi Wu, Peng Yuan, Kewei Yu(CST, #5415). Precipitated DNA was analyzed by qPCR using SimpleChIP Universal qPCR Master Mix (CST, #88989 s). FasL promoter enrichment was assessed using primers: forward 5′‐AGCAGTCAGCGTCAGAGTTC‐3′, reverse

(3) The MIRO1-BAX Complex Dictates Life and Death at the Mitochondrial GatebioRxivJuly 1, 2026Alva G. Sainz, Chulhwan S. Kwak, Kwang Bog Cho, Sejal A. Sripadanna, Brandon H. Bergsneider, Zoe Zizzo, Aarooran S. Durairaj, Zehui Du, Ian Cooney, Anthony Venida, et al.Technology). Enrichment of immunoprecipitated DNA was analyzed by qRT-PCR using SimpleChIP Universal qPCR Master Mix (88989, Cell Signaling Technology) according to manufacturer’s instructions on a CFX96 Real-Time PCR Detection System

(4) L1CAM signaling through planar cell polarity drives SOX2 expression and lung adenocarcinoma metastasisNature CommunicationsJune 18, 2026Jin Suk Park, Yasemin Kaygusuz, Carson Kenum, Lan He, Mohamed I. Gatie, Xueqian Zhuang, Roshan Sharma, Ronan Chaligné, Umesh K. Bhanot, Richard P. Koche, et al.were analyzed by qRT-PCR using SimpleChIP universal qPCR master mix (Cell Signaling Technology Cat# 88989), and results were quantified as a percent of the total input chromatin using the equation: percent

(5) Identification of the MRTFA/SRF pathway as a critical regulator of quiescence and chemotherapy resistance in cancerCancer LettersMay 28, 2026Santiago Panesso-Gómez, Alexander J. Cole, Austin Arrigo, Alex Roberts, Maya Bello, Alyssa Wield, Vivian I. Anyaeche, Stacy McGonigal, Amjad Hijazi, Jaynish Shah, et al.manufacturer’s instructions. qPCR was performed using SimpleChIP Universal qPCR Master Mix (Cell Signaling, 88989) with primers (Sup Table 3) targeting promoter regions with published SRF binding affinity (UCSC Genome

(6) Fra-2 controls the response to the KRAS inhibitor MRTX-1133 in pancreatic ductal adenocarcinomaProceedings of the National Academy of SciencesMay 5, 2026Erika Testa, Clara Dezi, Francesca Lovat, Geny Piro, Carmine Carbone, Marina Capece, Giovanni Nigita, Erisa Putro, Elisabetta Di Renzi, Alessandra Simeone, et al.purified and analyzed by the real-time quantitative PCR using SimpleChIP Universal qPCR Master Mix (Cat. # 88989, Cell Signaling Technology). Data were analyzed with the fold enrichment method compared to an unrelated

(7) IL-3/STAT5/miR-155-5p axis supports stem-related pathway reprogramming in TNBCBreast Cancer ResearchNovember 3, 2025Alessandro Sarcinella, Sharad Kholia, Saveria Femminò, Massimo Cedrino, Marta Tapparo, Xiaofen Wen, Maria Rosaria De Miglio, Vincenzo Salemme, Andrea Scavuzzo, Matteo Poncina, et al.was quantified by qRT-PCR using the SimpleChIP Universal qPCR Master mix (Cell Signalling Technology #88989) following the manufacturer’s protocol. PCR primers for the BIC (MIR155HG) promoter upstream regions

(8) Histone Deacetylase Inhibitors orchestrate epigenetic signalling and alter the nucleoporins and nuclear envelope in cervical cancerTranslational OncologyNovember 1, 2025Harsha Rani, Shabir Ahmad Ganai, Vijayalakshmi Mahadevanmanufacturer instructions. Real-time-PCR analysis was performed using Universal SYBR master mix (CST # 88989S) on the Applied Biosystems StepOnePlus Real-Time PCR System with the following conditions: 3 min at

(9) Tumor-Derived Lactate Drives Malignant Progression of Refractory Papillary Thyroid Carcinoma via the H3K18la-STAT1-LDHA AxisInternational Journal of Biological SciencesOctober 1, 2025Zheng Zhou, Chao He, Xumeng Wang, Xinguang Jin, Liping Wen, Yan Yang, Quan Zhou, Weibin Wang, Lisong TengReleased DNA was purified (CST, #14029) and analyzed by qPCR (SimpleChIP® Universal qPCR Master Mix, CST, #88989). Dual-Luciferase Reporter Assay The STAT1 promoter region (-2000 to 0 bp) was cloned into pGL3-basic

(10) Lactate modulates the function of myeloid-derived suppressor cells via Ten-Eleven-Translocation-2-mediated demethylation of glucocorticoid-inducible kinase 1 in lung cancer modelFrontiers in Cell and Developmental BiologyAugust 22, 2025Ying Chu, Hua Shen, Qiu Li, Bo Shen, Yan Zhang, Deqiang Wang, Wei Zhu, Shengjun Wang, Jie MaFor ChIP-PCR, DNA samples and standards were analyzed using SimpleChIP® Universal qPCR Master Mix (#88989, Cell Signaling Technology, Beverly, MA, United States of America) on the Bio-Rad CFX96 Real-time System

(11) Activation of PERK/eIF2α/ATF4 signaling inhibits ERα expression in breast cancerNeoplasiaApril 18, 2025Yuanli Wu, Gang Wang, Ruixue Yang, Duanfang Zhou, Qingjuan Chen, Qiuya Wu, Bo Chen, Lie Yuan, Na Qu, Hongmei Wang, et al.(CST, Danvers, MA, USA). DNA was amplified using PCR with SimpleChIP® Universal qPCR Master Mix (Cat# 88989s; Cell Signaling Technology Inc.). PCR was performed under the following reaction conditions: initial

(12) AZIN1 level is increased in medulloblastoma and correlates with c-Myc activity and tumor phenotypeJournal of experimental & clinical cancer research : CRFebruary 17, 2025Sesen J, Martinez T, Busatto S, Poluben L, Nassour H, Stone C, Ashok K, Moses MA, Smith ER, Ghalali A.The ChIP-DNA was analyzed by qPCR using SimpleChIP® Universal qPCR Master Mix (Cell Signaling, cat # 88989) according to the manufacturer’s instructions. Primers that are targeting regions of interest are listed

(13) NKX2.2 and KLF4 cooperate to regulate α-cell identityGenes & DevelopmentFebruary 3, 2025Elliott P. Brooks, McKenna R. Casey, Kristen L. Wells, Tsung-Yun Liu, Madeline Van Orman, Lori Sussel50%. Cell Signaling Technologies SimpleChIP Universal qPCR master mix (Cell Signaling Technologies 88989P) was used to amplify genomic loci on a Bio-Rad CFX96 real-time machine using the standard SimpleChIP

(14) NCAPD3 promotes diffuse large B-cell lymphoma progression through modulating SIRT1 expression in an H3K9 monomethylation-dependent mannerJournal of Advanced ResearchFebruary 1, 2025Tiange Lu, Juan Yang, Yiqing Cai, Mengfei Ding, Zhuoya Yu, Xiaosheng Fang, Xiangxiang Zhou, Xin Wang(9002S, Cell Signaling Technology (CST), Danvers, MA, USA) and SimpleChIP Universal qPCR Master Mix (88989S, CST) according to the manufacturer’s instructions. The primary antibody was GTF2I (A301-330A-T, Bethyl laboratories

(15) The Activation of p300 Enhances the Sensitivity of Pituitary Adenomas to Dopamine Agonist Treatment by Regulating the Transcription of DRD2International Journal of Molecular SciencesNovember 21, 2024Sihan Li, Xingbo Li, Quanji Wang, Qian Jiang, Zihan Wang, Linpeng Xu, Yimin Huang, Ting Leispin columns. Real-time quantitative PCR was performed using SimpleChIP® Universal qPCR Master Mix (#88989, CST, Danvers, MA, USA). The efficiency of the IP was calculated using the percentage of input method.

(16) Long-term breast cancer response to CDK4/6 inhibition defined by TP53-mediated geroconversionCancer cellNovember 11, 2024Kudo R, Safonov A, Jones C, Moiso E, Dry JR, Shao H, Nag S, da Silva EM, Yildirim SY, Li Q, et al.reactions were performed using the SimpleChIP Universal qPCR Master Mix (Cell Signaling Technology #88989) according to manufacturer’s protocol. Signals of ChIP samples were normalized to their respective input

(17) Meis1 Targets Protein Tyrosine Phosphatase Receptor J in Fibroblast to Retard Chronic Kidney Disease ProgressionAdvanced ScienceOctober 1, 2024Mi Bai, Shuang Xu, Mingzhu Jiang, Yuxian Guo, Dandan Hu, Jia He, Ting Wang, Yu Zhang, Yan Guo, Yue Zhang, et al.SimpleChIP Enzymatic Chromatin IP Kit (Magnetic Beads, Cat No. 9003S), and SimpleChIP Universal qPCR Master Mix (Cat No. 88989P) were from Cell Signaling Technology (Boston, MA, USA). TGF‐β1 was from Pepro Tech (Cat No. 100‐21‐10

(18) Loss of p53 epigenetically modulates epithelial to mesenchymal transition in colorectal cancerTranslational OncologyMay 1, 2024Shreya Sharma, Harsha Rani, Yeshwanth Mahesh, Mohit Kumar Jolly, Jagannath Dixit, Vijayalakshmi Mahadevanmanufacturer instructions. Real-time-PCR analysis was performed using Universal SYBR master mix (CST # 88989S) on the Applied Biosystems StepOnePlus Real-Time PCR System with the following conditions: 3 min at

(19) A Druggable FOXA1-Glucocorticoid Receptor Transcriptional Axis Drives Tumor Growth in a Subset of Non-Small Cell Lung CancerCancer Res CommunSeptember 7, 2023M. Dorso, Payal T. Patel, Aleksandr Pankov, Jacob A. Boyer, Rajesh K. Soni, Isabella S. Del Priore, Omar Hayatt, Amanda Kulick, Connor J. Hagen, Elisa de Stanchina, et al.analysis, reactions were performed using SimpleChIP Universal qPCR Mastermix (Cell Signaling Technology #88989) according to the manufacturer's protocol. ChIP primer sequences were derived from FOXA1/GR binding

(20) A Druggable FOXA1-Glucocorticoid Receptor Transcriptional Axis Drives Tumor Growth in a Subset of Non-Small Cell Lung CancerCancer Research CommunicationsSeptember 7, 2023M. Dorso, Payal T. Patel, Aleksandr Pankov, Jacob A. Boyer, Rajesh K. Soni, Isabella S. Del Priore, Omar Hayatt, Amanda Kulick, Connor J. Hagen, Elisa de Stanchina, et al.analysis, reactions were performed using SimpleChIP Universal qPCR Mastermix (Cell Signaling Technology #88989) according to the manufacturer's protocol. ChIP primer sequences were derived from FOXA1/GR binding

Be the First to Write a Review!

SimpleChIP ® Universal qPCR Master Mix from Cell Signaling Technology

Cell Signaling Technology

Citations (34)

Reviews

SimpleChIP ® Universal qPCR Master Mix from Cell Signaling Technology

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map