BsrI from New England Biolabs

Product Specs
ItemBsrI
CompanyNew England Biolabs
Price $72.00 Inquire
Catalog NumberR0527S
Quantity1000 units
ApplicationsDNA Manipulation
Concentration5 u/µL
TypeRestriction Enzyme
Temperature-20 C

Sequence

ACTGG(1/-1)

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Ribosomal protection as a linezolid resistance mechanism in Mycobacterium abscessusAntimicrobial Agents and ChemotherapyMarch 2, 2026Tobias Funck, Kerry McGowen, Mark R. Sullivan, Samuel Zinga, Ian D. Wolf, Dennis Nurjadi, Claudia M. Denkinger, Eric J. Rubinfrom ATC19977 gDNA) or mNeonGreen using standard restriction cloning with NdeI (R0111S, NEB) and PacI (R0527S, NEB). PURExpress reactions were set up following the manufacturer’s protocol with either no template,

(2) Ribosomal protection as a linezolid resistance mechanism in Mycobacterium abscessusbioRxivOctober 28, 2025Tobias Funck, Kerry McGowen, Mark R. Sullivan, Samuel Zinga, Ian D. Wolf, Dennis Nurjadi, Claudia M. Denkinger, Eric J. Rubinfrom ATC19977 gDNA) or mNeonGreen using standard restriction cloning with NdeI (R0111S, NEB) and PacI (R0527S, NEB). PURExpress reactions were set up following the manufacturer’s protocol with either no template,

(3) Directly Measuring Atherogenic Lipoprotein Kinetics in Zebrafish With the Photoconvertible LipoTimer ReporterArteriosclerosis, Thrombosis, and Vascular BiologyOctober 1, 2025Tabea O.C. Moll, Julia G. Kiefer, Mackenzie L. Klemek, Meredith H. Wilson, Steven A. FarberPCR product was then digested using the BsrI restriction enzyme (3 units of BsrI (New England Biolabs, R0527) in New England Biolabs Buffer 3.1 (B7203)) as the mutation introduces a cut site, leading to a WT band

(4) Activity-driven myelin sheath growth is mediated by mGluR5Nature NeuroscienceMay 14, 2025Philipp N. Braaker, Xuelong Mi, Daniel Soong, Jenea M. Bin, Katy Marshall-Phelps, Stephen Bradley, Silvia Benito-Kwiecinski, Julia Meng, Donia Arafa, Claire Richmond, et al.5′-ACTATGTCCACCATGGCTCTG-3′ to amplify the grm5b locus. We digested the PCR product with the restriction enzyme BseNI (NEB: R0527S). For wild-type grm5b, the genotyping primers amplify a 290 bp product that is cut by BseNI into 196

(5) Directly Measuring Atherogenic Lipoprotein Kinetics in Zebrafish with the Photoconvertible LipoTimer ReporterbioRxivJune 4, 2024Tabea O.C. Moll, Mackenzie L. Klemek, Steven A. FarberPCR product was then digested using the BsrI restriction enzyme (3 units of BsrI (New England Bio- Labs, R0527) in New England BioLabs Buffer 3.1 (B7203)) as the mutation introduces a cut site, leading to a WT band

(6) Harnessing non-Watson–Crick’s base pairing to enhance CRISPR effectors cleavage activities and enable gene editing in mammalian cellsProceedings of the National Academy of SciencesJanuary 9, 2024Shuliang Gao, Huiwen Guan, Hanan Bloomer, Douglas Wich, Donghui Song, Jennifer Khirallah, Zhongfeng Ye, Yu Zhao, Mengting Chen, Chutian Xu, et al.following restriction endonucleases were used: BsrFI (NEB, R0739S), BstYI (NEB, R0523S), BsrI (NEB, R0527S), FauI (NEB, R0651S), EcoRI (NEB, R0101S). Then, reactions were terminated by adding 5 µL Gel Loading Dye, Purple (6X

(7) Stripes and loss of color in ball pythons (Python regius) are associated with variants affecting endothelin signalingG3: Genes, Genomes, GeneticsJuly 5, 2023Uyen M Dao, Izabella Lederer, Ray L Tabor, Basmah Shahid, Chiron W Graves, Hannah S Seidel, Bayan Abdeljalil, Garrett Bailey, John (Teddy) Belman, Keith Camac, et al.EDNRB1 via PCR and digesting the PCR products with the restriction enzyme BsrI (New England BioLabs, #R0527S). Both deletions eliminate cut sites for BsrI and can thus be genotyped simultaneously (Supplementary

(8) Kunjin Virus, Zika Virus, and Yellow Fever Virus Infections Have Distinct Effects on the Coding Transcriptome and Proteome of Brain-Derived U87 CellsVirusesJune 23, 2023Carolin Brand, Gabrielle Deschamps-Francoeur, Kristen M. Bullard-Feibelman, Michelle S. Scott, Brian J. Geiss, Martin Bisaillonprotocols. RNA was stabilized for storage using an RNA transport kit (OMEGA bio-tek, Norcross, GA, USA, R0527). PolyA-RNA was purified from 5 μg total RNA using NEB magnetic mRNA Isolation Kit (NEB, Ipswitch, MA,

(9) Genome concentration, characterization, and integrity analysis of recombinant adeno-associated viral vectors using droplet digital PCRPLOS ONEJanuary 25, 2023Andrew Prantner, Dianna MaardEXD15274642) and eGFP HEX (Bio-Rad, dEXD22434642). Restriction enzymes were from New England Biolabs (BsrI, R0527; SmaI, R0141; MspI, R0106L). For the BsrI/SmaI double digestion, 5 U of each enzyme was added to the

(10) Allele-specific aberration of imprinted domain chromosome architecture associates with large offspring syndromeiScienceMay 20, 2022Yahan Li, Frimpong Boadu, Max R. Highsmith, Darren E. Hagen, Jianlin Cheng, Rocío Melissa Rivera(New England Biolabs, R0525S) were used for IGF2R_MseI, and NlaIII (first RE) and BsrI (New England Biolabs, R0527S) were used for IGF2R_BsrI. For the first round of PCR, primer 4C_KvDMR1_F (5’- TACACGACGCTCTTCCGATCT/CTCAGCGCCCAGCTTAC,

(11) A point mutation decouples the lipid transfer activities of microsomal triglyceride transfer proteinPLoS geneticsAugust 1, 2020Wilson MH, Rajan S, Danoff A, White RJ, Hensley MR, Quinlivan VH, Recacha R, Thierer JH, Tan FJ, Busch-Nentwich EM, et al.restriction site into the amplicon, such that following digestion (3 units of BsrI (New England BioLabs, R0527) in New England BioLabs Buffer 3.1 (B7203), 65˚C, 3.5 h) the WT band is 137 bp, homozygous mutants have

(12) Cadherin-Mediated Cell Coupling Coordinates Chemokine Sensing across Collectively Migrating CellsCurrent BiologyAugust 1, 2019Tugba Colak-Champollion, Ling Lan, Alisha R. Jadhav, Naoya Yamaguchi, Gayatri Venkiteswaran, Heta Patel, Michael Cammer, Martin Meier-Schellersheim, Holger KnautE10521–50G Low melt agarose (AquaPor HR),National Diagnostics,Cat No EC-205 (100g) BsrI,New England Biolabs,R0527S DdeI,New England Biolabs,R0175S Critical Commercial Assays,Critical Commercial Assays,Critical Commercial

(13) Anosmin1 Shuttles Fgf to Facilitate Its Diffusion, Increase Its Local Concentration, and Induce Sensory OrgansDevelopmental cellSeptember 24, 2018Wang J, Yin Y, Lau S, Sankaran J, Rothenberg E, Wohland T, Meier-Schellersheim M, Knaut H."Alexa Fluor 594 Carboxylic Acid, tris(triethylammonium) salt",Thermo Fisher,A33082 BsrI,New England Biolabs,R0527S Hpych4v,New England Biolabs,R0620L AciI,New England Biolabs,R0551S ApoI,New England Biolabs,R0566L Taqαi,New England Biolabs

(14) Serum Oxytocin Levels and an Oxytocin Receptor Gene Polymorphism (rs2254298) Indicate Social Deficits in Children and Adolescents with Autism Spectrum DisordersFrontiers in NeuroscienceApril 21, 2017Shuhan Yang, Xiaopeng Dong, Xuan Guo, Yu Han, Hanbing Song, Lei Gao, Wei Dai, Yuanyuan Su, Xin Zhangdigested at 65°C for 20 min with 0.5 μl of the restriction enzyme BsrI (New England Biolabs, Cat. #R0527), the samples were run at 80 V for 90 min on an 8% polyacrylamide gel (acrylamide/bis-acrylamide ratio

(15) Oxytocin receptor gene polymorphism (rs2254298) interacts with familial risk for psychopathology to predict symptoms of depression and anxiety in adolescent girlsPsychoneuroendocrinologyJanuary 1, 2011Renee J. Thompson, Karen J. Parker, Joachim F. Hallmayer, Christian E. Waugh, Ian H. Gotlibwas digested at 65°C for 3 hours with 5 U of the restriction enzyme BsrI (New England Biolabs, Cat#R0527L). The products were electrophoresed through 10% Polyacrylamide gel(Acrylamide/bis-Acrylamide ratio 19:1)

(16) TNFR-associated factor-2 (TRAF-2) in Alzheimer's diseaseNeurobiology of AgingOctober 22, 2007Doris Culpan, Dougal Cram, Kate Chalmers, Abigail Cornish, Laura Palmer, Jennifer Palmer, Anthony Hughes, Peter Passmore, David Craigs, Gordon K. Wilcock, Patrick G. Kehoe, Seth Love

Be the First to Write a Review!

BsrI

BsrI from New England Biolabs

Sequence

New England Biolabs

Citations (16)

Reviews

BsrI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map