GoTaq G2 Flexi DNA Polymerase M7805 from Promega

Product Specs
ItemGoTaq G2 Flexi DNA Polymerase
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberM7805
Size500u
Molecular Weight~125kDa

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) OT-Curtains: an approach for studying protein interactions with DNA ends using optical tweezers and confocal fluorescence microscopyNucleic Acids ResApril 28, 2026Sara De Bragança, Clara Aicart-Ramos, Ángel Rivera-Calzada, Raquel Arribas-Bosacoma, Mark S Dillingham, Oscar Llorca, Fernando Moreno-HerreroSupplementary Table S2, Frag. C for primer sequences) using GoTaq® G2 Flexi DNA Polymerase (Promega, #M7805) in a 100 μl reaction volume. The PCR reaction contained 200 µM each of dGTP, dCTP, and dATP, along

(2) Structure and function of persulfide dioxygenase from Pseudomonas aeruginosa: Implications on H2S homeostasis and interplay with nitric oxideiScienceFebruary 20, 2026Francesca Giordano, Francesca Troilo, Martina Roberta Nastasi, Lorenzo Caruso, Marta Mellini, Carlo Travaglini-Allocatelli, Giorgio Giardina, João B. Vicente, Giordano Rampioni, Adele Di Matteo, et al.Buffer),Promega,M1801 Hydrogen Sulfide Test Strips,Fluka,06728-25STRIPS-F GoTaq® G2 Flexi DNA Polymerase,Promega,M7805 ,, Deposited data,Deposited data,Deposited data ,, PDO structure,This paper,PDB: 9G8T ,, Oligonucleotides,Oligonucleotides,Oligonucleotides ,, FWpdoUP5’-CCGCTCGAGGTTGCTGCGACGCCATCC-3’,This

(3) Genomic analysis of Ostreococcus tauri-infecting viruses reveals a hypervariable region associated with host-virus interactionsVirus EvolFebruary 11, 2026Julie Thomy, Julien Henri, David Demory, Frederic Sanchez, Marie-Line Escande, Gilles Mirambeau, Nigel Grimsley, Sheree Yaueach primer, 0.1 mg.m−1 bovine serum albumin (BSA), and 1.25 U of Taq DNA polymerase (GOTaq® G2 Flexi M7805, Promega). PCR was performed in a Mastercycler Nexus system (Eppendorf) using an initial denaturation

(4) Measuring changes in Plasmodium falciparum census population size in response to sequential malaria control interventionsElifeOctober 28, 2025Kathryn E Tiedje, Qi Zhan, Shazia Ruybal-Pésantez, Gerry Tonkin-Hill, Qixin He, Mun Hua Tan, Dionne C Argyropoulos, Samantha L Deed, Anita Ghansah, Oscar Bangre, et al.#: U1511, U1515",See Appendix 1 Sequence-based reagent,GoTaq G2 Flexi DNA polymerase,Promega,Cat #: M7805,See Appendix 1 Sequence-based reagent,DBLaAF-MID,"Rask et al., 2016",Forward PCR primers,See Appendix

(5) Functional variants of CFAP410 affect the DNA damage response leading to motor neuron degeneration – Implications for ALSiScienceSeptember 19, 2025Ross Ferguson, Vasanta Subramanian22571020 Trizol,Gibco,Cat# 1559026 iQ5 Sybr green supermix,Biorad,Cat# 170-8880 GoTaq G2 Flexi,Promega,Cat# M7805 T7E1 Endonuclease,NEB,Cat# M0302L T4 Polynucleotide Kinase,Fisher,Cat# 10120670 T4 DNA Ligase,Fisher,Cat#

(6) Lasso peptides sviceucin and siamycin I exhibit anti-virulence activity and restore vancomycin effectiveness in vancomycin-resistant pathogensiScienceMarch 21, 2025Abdelhakim Boudrioua, Benjamin Baëtz, Solenn Desmadril, Christophe Goulard, Anne-Claire Groo, Carine Lombard, Sabrina Gueulle, Marie Marugan, Aurélie Malzert-Fréon, Axel Hartke, et al.,New England BioLabs®,Cat# M0491L NucleoSpin Plasmid kit,Macherey-Nagel,Cat# 740588.50 GoTaq DNA Polymerase,Promega,Cat# M7805 Luna C18(2) HPLC column,Phenomenex,Cat# 00G-4252-N0 Acclaim™ RSLC PolarAdvantage II,Thermo Fisher

(7) Comparative efficacy of selenoureido carbonic anhydrase inhibitors and azole antifungal drugs against clinical isolates of Malassezia pachydermatisVeterinary DermatologyMarch 16, 2025Costanza Spadini, Nicolò Mezzasalma, Amienwanlen Eugene Odigie, Andrea Angeli, Fabrizio Carta, Silvia Selleri, Emanuele Gandolfo, Simone Taddei, Valentina Franceschi, Sergio Minesso, et al.deoxynucleoside triphosphates (dNTPs, 2 mM), 1 U.I. of Taq DNA polymerase (GoTaq G2 Flexi DNA Polymerase M7805; Promega Corp.) and 6.5 μL of H2O. PCR was performed in a real‐time PCR (StepOne; Applied Biosystem).

(8) Pathogenic KIAA0586/TALPID3 variants are associated with defects in primary and motile ciliaiScienceFebruary 21, 2025Jacqueline E. Taudien, Diana Bracht, Heike Olbrich, Sebastian Swirski, Fulvio D’Abrusco, Bert Van der Zwaag, Maike Möller, Thomas Lücke, Norbert Teig, Ulrika Lindberg, et al.Fisher,Cat#15240062 Gibco™ RPMI medium,Thermo Fisher,Cat#21875-034 GoTaq G2 Flexi DNA Polymerase,Promega,Cat#M7805 HotFirePol DNA Polymerase,Solis BioDyne,Cat#01-02-00500 L-glutamine,Biowest,Cat#X0550 Minimum Essential

(9) A Study on Potential Sources of Perineuronal Net-Associated Sema3A in Cerebellar Nuclei Reveals Toxicity of Non-Invasive AAV-Mediated Cre Expression in the Central Nervous SystemInternational journal of molecular sciencesJanuary 19, 2025Gimenez GA, Romijn M, van den Herik J, Meijer W, Eggers R, Hobo B, De Zeeuw CI, Canto CB, Verhaagen J, Carulli D.MA, USA) and a PCR was performed using a GoTaq® Flexi DNA polymerase kit (Promega, Madison, WI, USA, #M7805) in the following conditions: 95 °C for 2 min (1 cycle), 95 °C for 30 s, 62 °C for 30 s, 72 °C for 2

(10) Altered Functional Responses of the Retina in B6 Albino Tyrc/c MiceInvestigative Ophthalmology & Visual ScienceAugust 27, 2024Virginie Chotard, Francesco Trapani, Guilhem Glaziou, Berat Semihcan Sermet, Pierre Yger, Olivier Marre, Alexandra Rebsam40 µL of ddH2O after being incubated at 65°C for 1 hour. PCR was done using a GoTaq DNA polymerase (M7805; Promega, Madison, WI, USA), using primers for Tyr mutation (Forward: CTGTGCCTCCTCTAAGAACTTGT; Reverse:

(11) Alternative Splicing Changes Promoted by NOVA2 Upregulation in Endothelial Cells and Relevance for Gastric CancerInternational Journal of Molecular SciencesApril 30, 2023Anna Di Matteo, Elisa Belloni, Davide Pradella, Anna Maria Chiaravalli, Giacomo Maria Pini, Mattia Bugatti, Roberta Alfieri, Chiara Barzan, Elena Franganillo Tena, Silvia Bione, et al.(1–2 μL) was then PCR-amplified (with GoTaq G2 Flexi DNA Polymerase, Promega, Madison, WI, USA, Cat# M7805). For quantitative PCR (qPCR), cDNA was amplified with QuantiTect SYBR Green PCR (QIAGEN, Cat# 204145)

(12) Deletion of classical transient receptor potential 1, 3 and 6 alters pulmonary vasoconstriction in chronic hypoxia-induced pulmonary hypertension in miceFrontiers in PhysiologyDecember 7, 2022Kathrin Malkmus, Monika Brosien, Fenja Knoepp, Lisa Schaffelhofer, Friedrich Grimminger, Christoph Rummel, Thomas Gudermann, Alexander Dietrich, Lutz Birnbaumer, Norbert Weissmann, et al.genomic DNA was mixed with genotyping solution using GoTaq® G2 Flexi DNA Polymerase Kit (Promega, #M7805) and Primers (0.1–0.2 µM) and followed by PCR. Afterwards, the PCR products were separated on a 1.5%

(13) Chromosome segregation fidelity requires microtubule polyglutamylation by the cancer downregulated enzyme TTLL11Nature communicationsNovember 21, 2022Zadra I, Jimenez-Delgado S, Anglada-Girotto M, Segura-Morales C, Compton ZJ, Janke C, Serrano L, Ruprecht V, Vernos I.cDNA was used for each stage for RT-PCR (Tm = 57 °C; 33 cycles), using GoTaq DNA polymerase (Promega, M7805). Oligonucleotide sequences are indicated in Supplementary Table S4. The pCS2-ttll11 construct was used

(14) Measuring cystic fibrosis drug responses in organoids derived from 2D differentiated nasal epitheliaLife science allianceAugust 3, 2022Amatngalim GD, Rodenburg LW, Aalbers BL, Raeven HH, Aarts EM, Sarhane D, Spelier S, Lefferts JW, Silva IA, Nijenhuis W, et al.iScript cDNA synthesis kit,Bio-Rad,#1708891 Quick-DNA Microprep Kit,Zymo Research,#D3020 GoTaq G2 Flexi DNA polymerase,Promega,#M7805 Experimental Models: Cell Lines,, Human nasal airway epithelial cells (HNEC),This paper,N/A Hek293T

(15) Fine-tuned KDM1A alternative splicing regulates human cardiomyogenesis through an enzymatic-independent mechanismiScienceJuly 15, 2022Astro V, Ramirez-Calderon G, Pennucci R, Caroli J, Saera-Vila A, Cardona-Londoño K, Forastieri C, Fiacco E, Maksoud F, Alowaysi M, et al.(Thermo Fisher Scientific, M1682). RT-PCR was conducted with GoTaq G2 Flexi DNA Polymerase (Promega, M7805) following standard PCR protocol. Exon inclusion frequency by relative quantity fluorescent RT-PCR Exon2a

(16) Mutations in exon 11 (11.1 and 11.2) of the BRCA1 gene and risk factors for breast cancer in Burkina FasoJournal of Public Health in AfricaMay 25, 2022Isabelle Touwendpoulimdé Kiendrebeogo et al.30 μL of nuclease-free water, 10 μL of Green Buffer 5X (Promega Go TaqR G2 Flexi DNA polymerase REF: M7805, 1 μL of each forward and reverse primer (Table 1), 1 μL of 20 nM dNTPs (Promega REF: U1420), 0.25 μL

(17) Ablation of the P21 Gene of Trypanosoma cruzi Provides Evidence of P21 as a Mediator in the Control of Epimastigote and Intracellular Amastigote ReplicationFrontiers in Cellular and Infection MicrobiologyFebruary 18, 2022Thaise Lara Teixeira et al.Lander et al., 2019). PCR was carried out with the following cycling conditions (GoTaq DNA polymerase M7805; Promega): initial denaturation for 2 min at 95°C, followed by 35 cycles for 30 s at 95°C, 20 s at 63°C,

(18) GDF15 and ACE2 stratify COVID-19 patients according to severity while ACE2 mutations increase infection susceptibilityFrontiers in cellular and infection microbiologyJanuary 1, 2022Torrens-Mas M, Perelló-Reus CM, Trias-Ferrer N, Ibargüen-González L, Crespí C, Galmes-Panades AM, Navas-Enamorado C, Sanchez-Polo A, Piérola-Lopetegui J, Masmiquel L, et al.by PrimerBLAST (Ye et al., 2012). PCRs were performed with GoTaq® G2 Flexi DNA Polymerase (Promega; M7805). PCR conditions were optimized by the Promega PCR design software (https://www.promega.es/resources/tools/biomath/tm-calculator/). PCR1

(19) Broadening the reach and investigating the potential of prime editors through fully viral gene-deleted adenoviral vector deliveryNucleic Acids ResearchNovember 18, 2021Qian Wang, Jin Liu, Josephine M Janssen, Francesca Tasca, Hailiang Mei, Manuel A F V Gonçalvesrecommendations. Next, the target sites were amplified with GoTaq G2 Flexi DNA Polymerase (Promega; Cat. No.: M7805). The primer sequences, PCR mixture compositions and cycling conditions are specified in Supplementary

(20) A ligand-insensitive UNC5B splicing isoform regulates angiogenesis by promoting apoptosisNature communicationsAugust 11, 2021Pradella D, Deflorian G, Pezzotta A, Di Matteo A, Belloni E, Campolungo D, Paradisi A, Bugatti M, Vermi W, Campioni M, et al.Resulting cDNA (1/20 v/v) was then PCR amplified with the GoTaq G2 Flexi DNA Polymerase (Promega, #M7805) according to the manufacturer’s instructions. For RT-qPCR, an aliquot of the RT reaction was analyzed

Be the First to Write a Review!

GoTaq G2 Flexi DNA Polymerase

GoTaq G2 Flexi DNA Polymerase from Promega

Description

Promega

Citations (34)

Reviews

GoTaq G2 Flexi DNA Polymerase from Promega

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map