GoTaq G2 Hot Start Polymerase M7408 from Promega

Product Specs
ItemGoTaq G2 Hot Start Polymerase
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberM7408
Size10,000u

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) Knock Down of Chlamydomonas reinhardtii Phytyl Ester Synthase α Triggers DGAT3 Overexpression and Triacylglycerol Accumulation Under Low-Light ConditionsPlants (Basel)October 1, 2025Félix Eduardo Zegarra Borlando, Gerardo Martín Oresti, Natalia Pavia, María Verónica Beligni, Gabriela GonorazkyPCR reactions for PESα amplification contained 0.05 U·µL−1 GoTaq G2 Hot Start Polymerase from Promega (cat. no. M7401; Madison, WI, USA) and were performed under the following conditions: holding stage, 95 °C for 5 min;

(2) Park entrances, commonly contaminated with infective Toxocara canis eggs, present a risk of zoonotic infection and an opportunity for focused interventionPLoS Negl Trop DisMarch 27, 2025Jason D. Keegan, Paul M. Airs, Claire Brown, Anya Rishi Dingley, Conor Courtney, Eric R. Morgan, Celia V. Hollandconducted. PCR and Sanger sequencing PCR was performed using GoTaq G2 Hot Start polymerase (Promega, Cat: M7401) as per the manufacturer’s instructions, using previously designed ascarid-specific XZ1 (5′-ATTGCGCCATCG

(3) High Diversity and Low Genetic Differentiation Among Geographic Populations of Myotis yumanensis in Western CanadaAnimals (Basel)February 18, 2025Xingyuan Su, Nicolas Popescu, Chadabhorn Insuk, Cori Lausen, Jianping XuColorless GoTaq Flexi Buffer, Magnesium Chloride, and GoTaq G2 Hot Start Taq Polymerase (Catalog number: M7405) (Promega, Madison, WI, USA).

(4) Characterization of the angiomodulatory effects of Interleukin 11 cis- and trans-signaling in the retinaJournal of neuroinflammationSeptember 18, 2024Liang P, Ness J, Rapp J, Boneva S, Schwämmle M, Jung M, Schlunck G, Agostini H, Bucher F.(#M7918, Promega), 0.4 µL dNTP 10mM (#R0192, Thermo Fisher Scientific), 0.1 µL GoTaq G2 Polymerase (#M7408, Promega) and 2 µL of primers (5 µM, Suppl. Table S1) per sample. PCR products or a DNA ladder (GeneRuler 50 bp DNA Ladder

(5) The Effects of Smoking on Telomere Length, Induction of Oncogenic Stress, and Chronic Inflammatory Responses Leading to AgingCellsMay 21, 2024Shreya Deb, Joseph Berei, Edward Miliavski, Muhammad J. Khan, Taylor J. Broder, Thomas A. Akurugo, Cody Lund, Sara E. Fleming, Robert Hillwig, Joseph Ross, et al.1000 bp upstream of the start codon (ATG). A master mix was made using 4 µL of a 5× buffer (Cat. No. M7405) purchased from Promega (Madison, WI, USA), 0.4 µL of dNTP (Cat. No. R0191), 2.5 µL of MgCl2, 1.4 µL

(6) Extracting, filtering and simulating cellular barcodes using CellBarcode toolsNature Computational ScienceFebruary 19, 2024Wenjie Sun, Meghan Perkins, Mathilde Huyghe, Marisa M. Faraldo, Silvia Fre, Leïla Perié, Anne-Marie Lyneand P7-index oligos to perform NGS DNA sequencing. The PCR was performed with Taq polymerase (Promega M7406) for 22 cycles (30 s at 95 °C, 30 s at 53 °C, 30 s at 72 °C). The sequences of the primers are the following: P5

(7) Dynamics of Virological and Clinical Response Parameters of Bulevirtide Treatment for Hepatitis D: Real-World DataGastro Hep AdvancesJanuary 5, 2024Alexander Killer, Smaranda Gliga, Carolin Lohr, Christian Weigel, Björn-Erik Ole Jensen, Nadine Lübke, Andreas Walker, Jörg Timm, Johannes Bode, Tom Luedde, et al.°C and 4 °C.14, 15 A 2-step semi-nested PCR was performed with GoTaq HotStart-Polymerase (Promega, #M7401) according to the manufacturer’s protocol and the following primer combinations for PCR I: HDV-891F

(8) Low-cost molecular methods to characterise gastrointestinal nematode co-infections of goats in AfricaParasites & VectorsJune 29, 2023Paul M. Airs, Javier Ventura-Cordero, Winchester Mvula, Taro Takahashi, Jan Van Wyk, Patson Nalivata, Andrews Safalaoh, Eric R. Morganvitrinus PCR, but no T. vitrinus was identified in this study. GoTaq® G2 Hot Start Taq Polymerase (cat. M7405, Promega, WI, USA) was used for all PCR reactions according to the manufacturer's instructions with

(9) Sequence diversity of hepatitis D virus in MongoliaFrontiers in MedicineMarch 13, 2023Battur Magvan, Anne Alina Kloeble, Johannes Ptok, Daniel Hoffmann, Daniel Habermann, Anuujin Gantumur, Martha Paluschinski, Gerelmaa Enebish, Vera Balz, Johannes C. Fischer, et al.and 4°C (31, 32). A two-step semi-nested PCR was performed with GoTaq HotStart-Polymerase (Promega, #M7401) according to the manufacturer’s protocol and the following primer combinations for PCRI: HDV-891F (AGGTCGGACCGCGAGGAGGT);

(10) Development of epigenetic biomarkers for the identification of sex and thermal stress in fish using DNA methylation analysis and machine learning proceduresMolecular Ecology ResourcesFebruary 1, 2023Alejandro Valdivieso, Dafni Anastasiadi, Laia Ribas, Francesc PiferrerThermo Fisher Scientific), 0.5 μl forward and reverse primers (10 μm; Life Technologies), 5 μl 5× Green GoTaq Flexi Buffer (M7405; Promega), 0.12 μl GoTaq G2 Hot Start polymerase (M7405; Promega) and 10.8 μl MilliQ autoclaved water.

(11) Generation of the First Human In Vitro Model for McArdle Disease Based on iPSC TechnologyInternational journal of molecular sciencesNovember 12, 2022Ortuño-Costela MDC, Cerrada V, Moreno-Izquierdo A, García-Consuegra I, Laberthonnière C, Delourme M, Garesse R, Arenas J, Fuster García C, García García G, et al.(5′-CTTAAGTCAAGATCGCCAGCTC-3′) for 35 cycles with the GoTaq® G2 Hot Start Polymerase (Promega, Madison, WI, USA; #M7406). The PCR products were purified from the gel using the NZYGelpure kit (NzyTech, Lisbon, Portugal; #MB01102).

(12) Choice of template delivery mitigates the genotoxic risk and adverse impact of editing in human hematopoietic stem cellsCell stem cellOctober 6, 2022Ferrari S, Jacob A, Cesana D, Laugel M, Beretta S, Varesi A, Unali G, Conti A, Canarutto D, Albano L, et al.200-074-012 MEGAscript T7 Transcription Kit,Thermo Fisher,Cat# AM1333 GoTaq G2 DNA Polymerase,Promega,Cat# M7401 ,, Deposited data,Deposited data,Deposited data ,, Targeted deep sequencing data,This paper,GEO:

(13) Generation, maintenance, and monitoring of gnotobiotic miceSTAR ProtocolsJune 1, 2021Amanda Z. Zucoloto, Ian-Ling Yu, Kathy D. McCoy, Braedon McDonaldSharpe (MRS) Broth",Sigma-Aldrich,69966 dNTP Mix,Promega,U1511 GoTaq G2 Hot Start Polymerase,Promega,M7401 "Paraformaldehyde, 97%",Alfa Aesar,A11313 Safranin,VWR,10143-254 Stabilized Iodine,VWR,10143-256 SYTOX™ Green Nucleic Acid Stain - 5 mM Solution in DMSO

(14) A SARS-CoV-2 neutralizing antibody with extensive Spike binding coverage and modified for optimal therapeutic outcomesNature communicationsMay 11, 2021Guo Y, Huang L, Zhang G, Yao Y, Zhou H, Shen S, Shen B, Li B, Li X, Zhang Q, et al.The sequencing library was generated by two-step nested PCR using GoTaq Polymerase (Promega, Catalog #M7406)44,45. In the first PCR, forward primers were priming on the T7 and with reverse primers priming on

(15) High Efficiency RNA Extraction From Sperm Cells Using Guanidinium Thiocyanate Supplemented With Tris(2-Carboxyethyl)PhosphineFrontiers in Cell and Developmental BiologyApril 21, 2021Martin Roszkowski, Isabelle M. MansuyTAGAGGTCTTTACGGATGTCAACG). For end-point PCR of cDNA from long RNAs, 5 ng of cDNA was amplified by GoTaq G2 HS Polymerase (M7405, Promega) for 30 cycles using specific primers for Malat1 (Forward (50 –30 ): ATCGATTTAAAGTAAATGGGCTA,

(16) Nuclear interacting SET domain protein 1 inactivation impairs GATA1-regulated erythroid differentiation and causes erythroleukemiaNature communicationsJune 12, 2020Leonards K, Almosailleakh M, Tauchmann S, Bagger FO, Thirant C, Juge S, Bock T, Méreau H, Bezerra MF, Tzankov A, et al.manufacturer’s protocol. Fifty nanograms of gDNA were amplified using the GoTaq G2 Hot Start Polymerase (Promega/M7405) under the following conditions: 94 °C 1 min, 60 °C 1 min, 72 °C 1 min for 25 cycles. PCR products were

(17) A dispensable paralog of succinate dehydrogenase subunit C mediates standing resistance towards a subclass of SDHI fungicides in Zymoseptoria triticiPLOS PathogensDecember 20, 2019Diana Steinhauer et al.genotypings such as CAPS markers or SSR analysis were amplified using GoTaq G2 Hot Start Polymerase (Promega, M7405). Each PCR was performed according to the conditions recommended by the respective manufacturers. Sanger sequencing

(18) Alcohol and endogenous aldehydes damage chromosomes and mutate stem cellsNatureJanuary 11, 2018Garaycoechea JI, Crossan GP, Langevin F, Mulderrig L, Louzada S, Yang F, Guilbaud G, Park N, Roerink S, Nik-Zainal S, et al.(HSC clones or tails) or 400 ng (donor bone marrow) of genomic DNA and GoTaq G2 Hot Start Polymerase (M7401, Promega). The first round of PCR amplifications was performed at 95 °C for 2 min, 35 cycles of 95 °C

(19) Anilinopyrimidine Resistance in Botrytis cinerea Is Linked to Mitochondrial FunctionFrontiers in MicrobiologyNovember 30, 2017Andreas Mosbach, Dominique Edel, Andrew D. Farmer, Stephanie Widdison, Thierry Barchietto, Robert A. Dietrich, Andy Corran, Gabriel Scallietrepresented mixed populations) or crossing progeny isolates with GoTaq® G2 Hot Start Polymerase (Promega, M7405). Pyrosequencing was performed on a PyroMark Q96 ID (Biotage/QIAGEN), according to the protocols provided

(20) Developing an Apicomplexan DNA Barcoding System to Detect Blood Parasites of Small Coral Reef FishesJournal of ParasitologyAugust 1, 2017Lance P. Renoux, Maureen C. Dolan, Courtney A. Cook, Nico J. Smit, Paul C. Sikkeland yellowtail damsels (M. chrysurus, n ¼ 6) was also screened. GoTaq Hot Start Polymerase kit (no. M7401, Promega, Fitchburg, Wisconsin) was used for all PCR analyses and performed on the Veriti 96 Well Thermal

Be the First to Write a Review!

GoTaq G2 Hot Start Polymerase

GoTaq G2 Hot Start Polymerase from Promega

Description

Promega

Citations (21)

Reviews

GoTaq G2 Hot Start Polymerase from Promega

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map