GoTaq G2 Flexi DNA Polymerase M7808 from Promega

Product Specs
ItemGoTaq G2 Flexi DNA Polymerase
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberM7808
Size10,000u

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) In vivo AGO-APP for cell-type- and compartment-specific miRNA profiling in the mouse brainCell Reports MethodsJanuary 26, 2026Surbhi Kapoor, Andrea Erni, Francesca Vincenzi, Beatrice Tessier, Vasika Venugopal, Gunter Meister, Alexandre Favereaux, Harold Cremer, Christophe Beclinproduct,3115801001 E. coli poly(A) polymerase,New England Biolabs,M0276S GoTaq® G2 Flexi DNA Polymerase,Promega,M7808 "PHUSION HIGH-FIDELITY DNA POLY MERASE, 100U",Thermo Fisher Scientific,F530S SuperScriptIII First

(2) Systematic analysis of A-to-I RNA editing upon release of ADAR from the nucleolusRNA BiologyDecember 31, 2025Ruben Lattuca, Rümeyza Bascetin, Vincent Detours, Denis L. J. LafontaineIII,11752–050,Invitrogen, GoTaq Flexi Buffer 5X,M890A,Promega, MgCl2,A351H,Promega, GoTaq G2 Flexi,M7808,Promega, Antibodies,,,Dilutions used: Anti-ADAR (E6X9R) rabbit,81284S,Cell Signaling,WB: 1/1000 Anti-ADARB1

(3) Disease mutation in gigaxonin-E3 ligase recapitulates giant axonal neuropathy in miceActa Neuropathologica CommunicationsDecember 16, 2025Caroline Liénard, Nicolas Pradeilles, Elisabeth Cortier, Cedric Hassen-Khodja, Leticia Arias, Maria Ceprian-Costoso, Antoine Picot, Anne-Laure Mausset-Bonnefont, Chantal Cazevieille, Frederic Fiore, et al.GAPDH-exon2-3 specific primers (ATGGTGAAGGTCGGTGTG and CATTCTCGGCCTTGACTG), with Go Taq Flexi kit (Promega #M7808). Behavioral phenotyping Behavioral studies were performed every 3 months, over a 24 month-period

(4) Interplay between autophagy, the unfolded protein response and the cytoplasmic heat stress response during heat stress in maizeBMC Plant BiologyNovember 29, 2025Jie Tang, Vishadinie Jayasinghe, Zhaoxia Li, Diane C. Basshamand 50 µL ddH2O was added to dissolve the DNA. Genotyping PCR was done using GoTaq G2 Flexi (Promega, M7801) as previously described [51]. Primers used are listed in Table 1. ATG8 lipidation analysis Maize

(5) Human iPSCs-based modeling unveils SETBP1 as a driver of chromatin rewiring in GATA2 deficiencyNature CommunicationsNovember 17, 2025Joan Pera, Damia Romero-Moya, Eric Torralba-Sales, Rebecca Andersson, Violeta García-Hernández, Maria Magallon-Mosella, Maximiliano Distefano, Clara Berenguer Balaguer, Julio Castaño, Francesca De Giorgio, et al.were examined. DNA Sanger sequencing Genomic DNA was isolated using QIAamp DNA Mini Kit (QIAGEN, #M7806) according to manufacturer’s protocol. PCR was performed with the primers, SETBP1-gDNA-PCR and ASXL1-gDNA-PCR

(6) Uniform dynamics of cohesin-mediated loop extrusion in living human cellsNature GeneticsNovember 14, 2025Thomas Sabaté, Benoît Lelandais, Marie-Cécile Robert, Michael Szalay, Jean-Yves Tinevez, Edouard Bertrand, Christophe Zimmersplit into a six-well plate and genomic DNA (gDNA) was extracted (Lucigen, QE0905T). PCR (Promega, M7801) genotyping was performed by amplifying 5′ and 3′ junctions (Supplementary Table 3)72. The unmodified

(7) Identificación molecular de la resistencia a organofosforados y carbamatos en Aedes aegypti de distintas edades fisiológicas en un cementerio del PerúRevista Peruana de Medicina Experimental y Salud PúblicaSeptember 29, 2025Rosa Elena Santillan-Valdivia, Mariano Manuel Yañez Cesti, Ruth Noemi Neyra-Palacios, Archi Alejandro Ruiz-Pologene, with a size of 190 bp, was performed using the PCR GoTaq™ G2 Flexi DNA Polymerase kit (Promega M7801), following the manufacturer’s instructions. The forward and reverse primers described by Loaiza 9 were

(8) Deep indel mutagenesis reveals the regulatory and modulatory architecture of alternative exon splicingNat CommunAugust 30, 2025Pablo Baeza-Centurión, Belén Miñana, Andre J. Faure, Mike Thompson, Sophie Bonnal, Gioia Quarantani, Joseph Clarke, Ben Lehner, Juan Valcárcel(Thermo Fisher, 18080085). PCR amplification of cDNA samples was performed with GoTaq flexi (PROMEGA, M7806) using a distinct 8-mer barcoded oligos to distinguish the nine experimental replicates. PCR products

(9) Caracterización molecular de Panstrongylus chinai del norte del Perú y su relación filogenética con poblaciones ecuatorianas empleando el gen COIRevista Peruana de Medicina Experimental y Salud PúblicaJune 9, 2025Archi Alejandro Ruiz-Polo, Angélica Maria Vigil-Correa, Lya Emilia Niño-Mendoza, Rosa Elena Santillan-Valdivia'5-TAAACTTCAGGGTGACCAAAAAATCA-3'). The reaction was performed using the GoTaq™ G2 Flexi DNA Polymerase PCR kit (Promega M7801), according to the manufacturer’s instructions. The final volume was 50 µL, containing 22.5 µL of nuclease-free

(10) A highly conserved neuronal microexon in DAAM1 controls actin dynamics, RHOA/ROCK signaling, and memory formationNat CommunMay 6, 2025Patryk Poliński, Marta Miret Cuesta, Alfonsa Zamora-Moratalla, Federica Mantica, Gerard Cantero-Recasens, Carlotta Viana, Miguel Sabariego-Navarro, Davide Normanno, Luis P. Iñiguez, Cruz Morenilla-Palao, et al.18080044) and oligo(dT)20 as advised by the manufacturer. GoTaq G2 Flexi DNA Polymerase enzyme (Promega, M7806) was used to amplify Daam1-MIC’s flanking exons, and PCR assays were performed with 25 cycles, 54 °C

(11) Modular in vivo assembly of Arabidopsis FCA oligomers into condensates competent for RNA 3’ processingThe EMBO JournalFebruary 24, 2025Geng-Jen Jang, Alex L Payne-Dwyer, Robert Maple, Zhe Wu, Fuquan Liu, Sergio G Lopez, Yanning Wang, Xiaofeng Fang, Mark C Leake, Caroline Dean,Thermo Fisher Scientific,F530S dNTP Set (100 mM),Thermo Fisher Scientific,10297018 GoTaq G2 Flexi DNA Polymerase,Promega,M7801 Gateway LR Clonase II Enzyme mix,Thermo Fisher Scientific,11791020 "cOmplete, EDTA-free Protease Inhibitor

(12) Niacin ameliorates Charcot-Marie-Tooth (CMT) 4B1 neuropathy without interfering with nerve regenerationBrain CommunicationsJanuary 31, 2025Silvia Cipriani, Emanuela Porrello, Matteo Cerea, Andrea Gazzaniga, Roberta Di Guardo, Amanda Heslegrave, Serena Valenzano, Ubaldo Del Carro, Phu Duong, John Svaren, et al.SIGMA, Merck Group, USA). PCR analysis was then performed using GoTaq G2 Flexi DNA Polymerase kit (M7806, PROMEGA, USA). Animals were randomly included into experimental groups according to genotyping, age

(13) A more significant role for insertion sequences in large-scale rearrangements in bacterial genomesmBioJanuary 8, 2025Wing Y. Ngan, Lavisha Parab, Frederic Bertels, Jenna Galliewere performed under standard conditions for High Performance GoTaq G2 Flexi DNA Polymerase (Promega; M7801), with the addition of 5× combined enhancer solution (41) per reaction. PCR products were visualized

(14) FB5P-seq-mAbs: monoclonal antibody production from FB5P-seq libraries for integrative single-cell analysis of B cellsFrontiers in ImmunologyDecember 17, 2024Sakina Ado, Chuang Dong, Noudjoud Attaf, Myriam Moussa, Agathe Carrier, Pierre Milpied, Jean-Marc Navarro49159-1KG Glycine,ThermoFisher Scientific,cat no. 15527-013 GoTaq G2 Flexi enzyme,Promega,cat no. M7801 HCl,Dutscher,cat no. 524526 KAPA HiFi ReadyMix,Roche Diagnostics,cat.no. 7958935001 LB Agar,ThermoFisher Scientific

(15) Comportamiento alimentario de Aedes aegypti en brotes de dengue de dos zonas rurales del Perú durante el ciclón Yaku y El Niño Global del 2023Revista Peruana de Medicina Experimental y Salud PúblicaOctober 21, 2024Archi Alejandro Ruiz-Polo, Rosa Elena Santillan-Valdivia, Cindy Yuriko Saavedra-Rios, Carlos Martin Nuñez-Rodriguez, Lya Emilia Niño-Mendozathe protocol proposed by Chena et al. 14, using the PCR kit GoTaq™ G2 Flexi DNA Polymerase (Promega M7801), and the primers proposed by Oshagi et al. 19 (Cytb 1: 5-CCCCTCAGAATGATATATTTGTCCTCA-3 and Cytb 2:

(16) Coexistencia y fuentes de alimentación de mosquitos adultos (Diptera: Culicidae) en un centro de salud rural en Piura, Perú 2024Revista Peruana de Medicina Experimental y Salud PúblicaOctober 21, 2024Archi Alejandro Ruiz Polo, Leslie Diana Luis Arismendiz, Lourdes Viviana Barrera Rivera, Arturo Alvarado Aldana, Kelina Isbelia Saavedra Cornejo, Jose Pablo Juárez Vilchezaccording to the indications by Chena et al. 10, and the protocol of the GoTaq™ G2 PCR kit (Promega M7801), using the primers designed by Oshagi et al. 16 (Cytb 1: 5-CCCCTCAGAATGATATATTTGTCCTCA-3 and Cytb 2:

(17) 3′-UTR Sequence of Exosomal NANOGP8 DNA as an Extracellular Vesicle-Localization SignalInternational Journal of Molecular SciencesJuly 2, 2024Manjusha Vaidya, Ayaka Kimura, Arjun Bajaj, Kiminobu SugayaGGATGGTCTCGATCTCCTGA 3’/reverse- 5’ CCCAATCCCAAACAATACGA 3’. Using GoTaq® G2 Flexi DNA Polymerase (Promega, Cat. # M7808), the PCR reactions were set up for the thermocycling program: 94 °C for 5 min, (denaturation: 94 °C

(18) ZebraReg—a novel platform for discovering regulators of cardiac regeneration using zebrafishFrontiers in Cell and Developmental BiologyMay 10, 2024Kateřina Apolínová, Ferran Arqué Pérez, Sylvia Dyballa, Benedetta Coppe, Nadia Mercader Huber, Javier Terriente, Vincenzo Di DonatoQuick DNA Extraction Solution 1.0 (COBO scientific, C20101). GoTaq® G2 Flexi DNA Polymerase (Promega, M7801). dNTPs NZYMix 10 mM (Nzytech, MB08605). Gene of interest-specific PCR primer (IDT Technologies).• Trpv4_ex1_Fw:

(19) Development and Characterisation of a New Patient-Derived Xenograft Model of AR-Negative Metastatic Castration-Resistant Prostate CancerCellsApril 12, 2024Daniel J. Turnham, Manisha S. Mullen, Nicholas P. Bullock, Kathryn L. Gilroy, Anna E. Richards, Radhika Patel, Marcos Quintela, Valerie S. Meniel, Gillian Seaton, Howard Kynaston, et al.5′-TAATGGCATAGGTGGAATG-3′ (PCR product = 801 bp) [37]. DNA was amplified using GoTaq G2 Flexi DNA polymerase (Promega, #M7801) according to the manufacturer’s instructions. Cycling conditions: 94 °C for 2 min, 35 cycles of 94

(20) Stratification of Fusobacterium nucleatum by local health status in the oral cavity defines its subspecies disease associationCell Host & MicrobeApril 10, 2024Madeline Krieger, Yasser M. AbdelRahman, Dongseok Choi, Elizabeth A. Palmer, Anna Yoo, Sean McGuire, Jens Kreth, Justin Merrittassays ZymoBIOMICS DNA Miniprep kit,Zymo Research,Cat. No. D4300 Taq Polymerase,Promega,Cat. No. M7806 AMPure XP beads,Beckman Coulter,Cat. No. A63881 Power SYBR Green Mastermix,Applied Biosystems,Cat.

Be the First to Write a Review!

GoTaq G2 Flexi DNA Polymerase

GoTaq G2 Flexi DNA Polymerase from Promega

Description

Promega

Citations (48)

Reviews

GoTaq G2 Flexi DNA Polymerase from Promega

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map