Hot StartTaqDNA Polymerase M0495S from New England Biolabs

Product Specs
ItemHot StartTaqDNA Polymerase
CompanyNew England Biolabs
Price $74.00 Inquire
Catalog NumberM0495S
Size200 units
ApplicationsDNA Analysis
TypeDNA Polymerase
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Strain-level antigen variation facilitates immune evasion in Bacteroides thetaiotaomicronJ ImmunolMarch 18, 2026Robert W P Glowacki, Jessica M Till, Orion D Brock, Vladimir Makarov, Morgan J Engelhart, Philip P AhernrRNA primer specific to Bacteroides species49 and 0.5 units Hot Start Taq Polymerase (NEB, Cat. no. M0495S). In total, 10 ng of template cDNA was used per reaction. To determine gene expression levels, the expression

(2) The Caenorhabditis Gli protein TRA-1 makes a transcriptional activator that promotes spermatogenesisiScienceDecember 19, 2025Yongquan Shen, Shin-Yi Lin, Yiqing Guo, Jibran Imtiaz, Kana Corley, Ronald E. Ellisproteins" ,, Cas9 Nuclease protein,Horizon Discovery,CAS12206 Hot Start Taq Polymerase,New England Biolabs,M0495L ,, Experimental models: Organisms/strains,Experimental models: Organisms/strains,Experimental models:

(3) High‐throughput generic single‐entity sequencing using droplet microfluidicsiMetaOctober 30, 2025Guoping Wang, Liuyang Zhao, Yu Shi, Fuyang Qu, Yanqiang Ding, Weixin Liu, Changan Liu, Gang Luo, Meiyi Li, Xiaowu Bai, et al.in‐droplet using T7 Endonuclease I (NEB, Cat. no. M0302L) and Hot Start Taq DNA Polymerase (NEB, Cat. no. M0495L). Barcoding was then achieved in a three‐droplet‐merger device, where the repaired genomic fragments

(4) AKAP12 Variant 1 Knockout Enhances Vascular Endothelial Cell MotilityJournal of Vascular ResearchJuly 18, 2025Ashrifa Ali, Bhaskar Roy, Micah B. Schott, Bryon D. Groveisolated clones was extracted using QuickExtract™ (QE09050), amplified using an NEB Hot Start Taq kit (M0495S) with primers spanning the gRNA target region (5′-CTTGTTTCTGACTTGGTCATGAGGACTG-3′ and 3′-CCAATCCACCACCAGGCAGTATG-5′),

(5) Clinical response to azacitidine in MDS is associated with distinct DNA methylation changes in HSPCsNat CommunMay 13, 2025Julie A. I. Thoms, Feng Yan, Henry R. Hampton, Sarah Davidson, Swapna Joshi, Jesslyn Saw, Chowdhury H. Sarowar, Xin Ying Lim, Andrea C. Nunez, Purvi M. Kakadia, et al.FAM probe), 2U HpaII (NEB #R0171L), 1U DraI (NEB #R0129L), 0.5U Hot Start Taq DNA Polymerase (NEB #M0495L)) were cycled at 37 °C for 15 min; 90 °C for 5 s; 95 °C for 2 min; then 10 cycles of 90 °C for 5 s,

(6) Inward transport of organelles drives outward migration of the spindle during C. elegans meiosisCell ReportsApril 22, 2025Alma P. Aquino, Wenzhe Li, Aastha Lele, Denisa Lazureanu, Megan F. Hampton, Rebecca M. Do, Melissa C. Lafrades, Maria G. Barajas, Antonio A. Batres, Francis J. McNallyStandard Taq Buffer,New England BioLabs,B0914S dNTPs,invitrogen,55085 Hot Start Taq,New England BioLabs,M0495S Myob:,, Tris-HCl,Fisher bioreagents,BP153-1 Tris-Base,Fisher bioreagents,BP152-1 Bacto-peptone,Fisher

(7) TET2 deficiency increases the competitive advantage of hematopoietic stem and progenitor cells through upregulation of thrombopoietin receptor signalingNat CommunMarch 10, 2025Yitong Yang, Severine Cathelin, Alex C. H. Liu, Amit Subedi, Abdula Maher, Mohsen Hosseini, Dhanoop Manikoth Ayyathan, Robert Vanner, Steven M. Chanprimers used are shown in Supplementary Table 1. Genotyping PCR was conducted using Taq polymerase (NEB, #M0495S) and buffer (ThermoFisher, #18067017). PCR products were visualized on 1.5% (w/v) agarose gels with

(8) Characterization of non-standard viral genomes during arenavirus infections identifies prominent S RNA intergenic region deletionsmBioOctober 16, 2024Matthew Hackbart, Carolina B. Lópezaccording to the manufacturer’s protocols. PCRs were performed with Hot Start Taq DNA Polymerase (NEB, M0495L). IGR delVG bands were separated on a 2% agarose gel. For qPCR quantification, cDNA was quantified with

(9) Splice-switching antisense oligonucleotide controlling tumor suppressor REST is a novel therapeutic medicine for neuroendocrine cancerMolecular Therapy - Nucleic AcidsSeptember 10, 2024Keishiro Mishima, Satoshi Obika, Masahito Shimojo(catalog no. 11756500; Thermo Fisher Scientific). cDNA was amplified using Hot Start Taq DNA Polymerase (M0495L; NEB, Ipswich, MA). Amplification was performed using a Dice Touch PCR Thermal Cycler (Takara Bio, Shiga,

(10) High levels of intra-strain structural variation in Drosophila simulans X pericentric heterochromatinGENETICSDecember 6, 2023Cécile Courret, Amanda M Larracuenteprimer—ACAGTTCGCGATGAGCTTCT). For each primer pair, we performed a PCR with NEB Taq polymerase (NEB #M0495) following the manufacturer's instructions (hybridization temperature: 53°). We sequenced each PCR product

(11) S RNA Intergenic Deletions Drive Viral Interference during Arenavirus InfectionsbioRxivNovember 7, 2023Matthew Hackbart, Carolina B. Lópezaccording to the manufacturer’s protocols. PCRs were performed with Hot Start Taq DNA Polymerase (NEB, M0495L). IGR delVG bands were separated on a 2% agarose gel. For qPCR quantification, cDNA was quantified with

(12) Therapeutic blockade of ER stress and inflammation prevents NASH and progression to HCCScience AdvancesSeptember 13, 2023Ebru Boslem, Saskia Reibe, Rodrigo Carlessi, Benoit Smeuninx, Surafel Tegegne, Casey L. Egan, Emma McLennan, Lauren V. Terry, Max Nobis, Andre Mu, et al.(denaturation/annealing/extension) and 68°C for 5 min (final extension) using 5 μl of cDNA (Hot start Taq DNA Polymerase, NEB, M0495S). Incubation of the amplicon at 4°C occurred for 5 min before the addition of 25 μl of the Pst I restriction

(13) CRISPR Gene Editing of Virulent Bacteriophage ICP1Cold Spring Harb ProtocApril 28, 2023Andrew Camilli(Fisher Scientific 41004) Gel loading buffer (10×) Hot Start Taq DNA Polymerase (New England Biolabs M0495) LB (Luria–Bertani) liquid medium Prepare LB as described in the recipe.Prepare LB with freshly

(14) Highly multiplexed selection of RNA aptamers against a small molecule libraryPLOS ONESeptember 15, 2022Brent Townshend, Matias Kaplan, Christina D. Smolkeconsisted of 1x Taq buffer (NEB, B9014), 1 mM MgCl2, 200 μM dNTPs (Kapa, KK1017), Hot-Start Taq (NEB, M0495), 0.01 U/μl USER enzyme (NEB, M5505), 300 nM primers (T7Z and X, S2 Table), and 2 μM blocking oligo

(15) Fast detection of SARS-CoV-2 RNA via the integration of plasmonic thermocycling and fluorescence detection in a portable device.Nature Biomedical EngineeringDecember 3, 2020Jiyong Cheong, Hojeong Yu, Chang Yeol Lee, Jung-uk Lee, Hyun-Jung Choi, Jae-Hyun Lee, Hakho Lee, Jinwoo CheonNIPPON Genetics EUROPE), 1 U FastGene Scriptase II (LS63-2; NIPPON Genetics EUROPE), 1 U Hot Start Taq DNA Polymerase (M0495; New England Biolabs), 0.4× Standard Taq Reaction Buffer (containing 10 mM Tris-HCl, 50 mM KCl and 1.5

(16) Efficient Propagation of Circulating Tumor Cells: A First Step for Probing Tumor MetastasisCancersSeptember 28, 2020Xiao J, McGill JR, Stanton K, Kassner JD, Choudhury S, Schlegel R, Sauna ZE, Pohlmann PR, Agarwal S.manufacturer specifications. PCR was performed on cDNA using Hot Start Taq DNA Polymerase (NEB cat. no. M0495) to test for the presence of epithelial (CK8, CK18), mesenchymal (VIM, SERP), and breast markers (MAM).

(17) BARX2 expression is downregulated by CpG island hypermethylation and is associated with suppressed cell proliferation and invasion of gastric cancer cellsOncology reportsJune 1, 2020Ma J, Xia LL, Yao XQ, Zheng SM, Li S, Xu LS, Sha WH, Li ZS.reaction mixture containing 2 µl complementary DNA and 0.2 U Hot Start Taq DNA polymerase (cat. no. M0495S; New England Biolabs, Inc.) and run for 30 cycles of denaturation (at 94°C for 30 sec), annealing (at

(18) A Ribose-Scavenging System Confers Colonization Fitness on the Human Gut Symbiont Bacteroides thetaiotaomicron in a Diet-Specific MannerCell Host & MicrobeJanuary 1, 2020Robert W. P. Glowacki, Nicholas A. Pudlo, Yunus Tuncil, Ana S. Luis, Peter Sajjakulnukit, Anton I. Terekhov, Costas A. Lyssiotis, Bruce R. Hamaker, Eric C. Martensdihydrate,Sigma-Aldrich,Cat#X0750 Yeast Extract,Fisher Scientific,Cat#BP1422 Dnase I,NEB,Cat#M0303 Hot Start Taq,NEB,Cat#M0495 10X Thermopol® Reaction Buffer,NEB,Cat#B9004 dNTPs,Invitrogen,Cat#10297018 MgSO4,NEB,Cat#B1003 RbsK

(19) BMP signaling is essential for sustaining proximo-distal progression in regenerating axolotl limbsDevelopmentJanuary 1, 2020Etienne Vincent, Eric Villiard, Fadi Sader, Sabin Dhakal, Benjamin H Kwok, Stéphane Roy(Life Technologies, S7580), 0.2 mM dNTP, 250 nM each forward and reverse primers, 0.5 U Hot Start Taq (NEB, M0495L) and including 2 µl of sample cDNA. All primers (Life Technologies) were tested for their efficiency

(20) Epithelial to mesenchymal transition is mediated by both TGF-β canonical and non-canonical signaling during axolotl limb regenerationScientific ReportsDecember 1, 2019Fadi Sader, Jean-François Denis, Hamza Laref, Stéphane Roy(Thermo Fisher Scientific, 10297018), 0.5 units of Hot Start Taq DNA polymerase (New England Biolabs, M0495S)] and the volume was completed to 20 µL with RNAse free water. Primers (forward and reverse) for each

Be the First to Write a Review!

Hot StartTaqDNA Polymerase

Hot StartTaqDNA Polymerase from New England Biolabs

New England Biolabs

Citations (27)

Reviews

Hot StartTaqDNA Polymerase from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map