Phusion Hot Start Flex DNA Polymerase M0535S from New England Biolabs

Product Specs
ItemPhusion Hot Start Flex DNA Polymerase
CompanyNew England Biolabs
Price $153.00 Inquire
Catalog NumberM0535S
Size100 units
ApplicationsDNA Analysis
TypeDNA Polymerase
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Assessing the Toxoplasma Tachyzoite Cell Cycle Phases Using Fluorescent Ubiquitination-Based Cell Cycle IndicatorBio ProtocJanuary 20, 2026Mrinalini Batra, Elena S. SuvorovaNagel, catalog number: 740609.50) 17. Phusion DNA Polymerase (New England Biolabs, catalog number: M0535S) 18. 10× Tris-Borate-EDTA (TBE) buffer (Bio-Rad, catalog number: 1610770) 19. Orange G powder (Fisher

(2) Assessing the Toxoplasma Tachyzoite Cell Cycle Phases Using Fluorescent Ubiquitination-Based Cell Cycle IndicatorBIO-PROTOCOLJanuary 20, 2026Mrinalini Batra, Elena S. SuvorovaNagel, catalog number: 740609.50) 17. Phusion DNA Polymerase (New England Biolabs, catalog number: M0535S) 18. 10× Tris-Borate-EDTA (TBE) buffer (Bio-Rad, catalog number: 1610770) 19. Orange G powder (Fisher

(3) Brain-immune interactions generate pathogen-specific sickness statesbioRxivDecember 8, 2025Zuri A. Sullivan, Bertrand J. Wong, Vikrant Kapoor, Paula Kathleen Vincze, Harris S. Kaplan, Pia Giraudet, Brianna R. Watson, Adel Misherghi, Sebastian Lourido, Jeffrey R. Moffitt, et al.each of the forward and reverse primers, 1× EvaGreen, 1× Phusion Hot Start Flex DNA Polymerase [NEB #M0535S]), stopping at a cycle during the exponential portion of the amplification process (typically <18 cycles).

(4) Discovering the complete enhancer map of human herpesviruses using a natural language processing modelNature CommunicationsDecember 2, 2025Nilabja Roy Chowdhury, Deepanway Ghosal, Vyacheslav Gurevich, Meir Shamay69506). PCR was performed on the isolated DNA with Phusion Hot Start Flex polymerase (NEB, Cat. No. M0535S), and amplicons were purified using Wizard SV Gel and PCR purification system (Promega, Cat. No. A9281).

(5) Functional characterization of the CRY2 circadian clock component variant p.Ser420Phe revealed a new degradation pathway for CRY2Journal of Biological ChemistryNovember 10, 2023Gizem Cagla Parlak, Ibrahim Baris, Seref Gul, Ibrahim Halil Kavaklithe template plasmid, and 0.02 unit/μl of Phusion Hot Start Flex DNA Polymerase (NEB, catalog no.: M0535S), with a final reaction volume of 50 μl. The PCR protocol involved an initial denaturation step at 98

(6) CTCF is a DNA-tension-dependent barrier to cohesin-mediated loop extrusionNatureApril 27, 2023Iain F. Davidson, Roman Barth, Maciej Zaczek, Jaco van der Torre, Wen Tang, Kota Nagasaka, Richard Janissen, Jacob Kerssemakers, Gordana Wutz, Cees Dekker, et al.(TCAGAGTGGCGGCCAGCAGGGGGCGCCCTTGCCAGA) were generated by PCR using Phusion Hot Start DNA polymerase (NEB, M0535S) and inserted into the plasmid pPlat (25,754 bp) at the FspAI (Thermo Fisher Scientific, ER1661) restriction

(7) Integrated transcriptome and proteome analysis reveals posttranscriptional regulation of ribosomal genes in human brain organoidseLifeMarch 29, 2023Sidhaye J, Trepte P, Sepke N, Novatchkova M, Schutzbier M, Dürnberger G, Mechtler K, Knoblich JA.PCRs were performed using Thermo Scientific Phusion Hot Start II DNA-Polymerase (New England Biolabs, M0535S). Plasmids for CRISPR-Cas9 gene editing For cloning guide sequences against SOX2, G3BP1, and TSC2

(8) Streamlined high-throughput cloning protocol to generate arrayed mutant librariesSTAR ProtocolsMarch 1, 2023Kerry T. Sun, Tark S. Patel, Justin Kim, Helen S.H. Tang, Ghazaleh Eskandari-Sedighi, Haresh Sureshkumar, Dean Schieve, S.A. MokScientific,Cat#SH3053802 Phusion Hot Start Flex DNA Polymerase - 500 units,New England Biolabs (NEB),Cat#M0535S "Dpni Restriction Enzyme, 20,000 units/mL, 5,000 units, New England Biolabs (NEB) R0176L",New England Biolabs

(9) The secondary pocket of cryptochrome 2 is important for the regulation of its stability and localizationThe Journal of biological chemistrySeptember 1, 2022Parlak GC, Camur BB, Gul S, Ozcan O, Baris I, Kavakli IH.ng of the template plasmid, and 1 unit of Phusion Hot Start Flex DNA Polymerase (NEB; catalog no.: M0535S) in a 50 μl of final volume. The reaction conditions were set to 98 °C for 30 s, 62 °C for 30 s, and

(10) Measuring the tolerance of the genetic code to altered codon sizeeLifeMarch 16, 2022Erika Alden DeBenedictis, Dieter SÃ¶ll, Kevin M Esveltlibrary, 200 μL of PCR product was produced using Phusion Hotstart Flex polymerase (New England Biolabs, M0535S). The entirety of this PCR product was run on a gel, extracted, and purified using spin column purification

(11) Measuring the tolerance of the genetic code to altered codon sizeElifeMarch 16, 2022Erika Alden DeBenedictis, Dieter Söll, Kevin M Esveltlibrary, 200 μL of PCR product was produced using Phusion Hotstart Flex polymerase (New England Biolabs, M0535S). The entirety of this PCR product was run on a gel, extracted, and purified using spin column purification

(12) Oncogene Concatenated Enriched Amplicon Nanopore Sequencing for rapid, accurate, and affordable somatic mutation detectionGenome BiologyDecember 1, 2021Deepak Thirunavukarasu, Lauren Y. Cheng, Ping Song, Sherry X. Chen, Mitesh J. Borad, Lawrence Kwong, Phillip James, Daniel J. Turner, David Yu Zhangwere appended to DNA by PCR using SAL adapter primers and Phusion Hot Start Flex DNA polymerase (NEB M0535S). For single-plex reactions, the following thermocycling protocol was used: 98 ∘C, 30s (98 ∘C, 20s;

(13) gbpA and chiA genes are not uniformly distributed amongst diverse Vibrio choleraeMicrobial GenomicsJune 8, 2021Thea G. Fennell, Grace A. Blackwell, Nicholas R. Thomson, Matthew J. Dormanprimers oMJD202 and oMJD203, high-fidelity Phusion Hot Start Flex polymerase [New England Biolabs (NEB); #M0535S] using the supplied GC buffer, DMSO (3 %, v/v, final concentration) and dNTPs (Thermo Scientific; #R0191).

(14) Prolactin synergizes with canonical Wnt signals to drive development of ER+ mammary tumors via activation of the Notch pathwayCancer LettersApril 1, 2021Kathleen A. O'Leary, Debra E. Rugowski, Michael P. Shea, Ruth Sullivan, Amy R. Moser, Linda A. Schuler(forward strand) and M13R (reverse strand) (Suppl. Table S1) using Phusion Hot Start (New England Biolabs M0535S) and 5ng of DNA. The PCR product was purified using the QIAquick PCR Purification Kit (Qiagen 28104)

(15) RNA timestamps identify the age of single molecules in RNA sequencingNature BiotechnologyMarch 1, 2021Samuel G. Rodriques, Linlin M. Chen, Sophia Liu, Ellen D. Zhong, Joseph R. Scherrer, Edward S. Boyden, Fei Chenthe cDNA product was analyzed by PCR with Phusion Hot Start Flex DNA Polymerase (New England Biolabs, M0535S), using a barcoded version of SGR-176 and a version of the 10x Genomics cDNA primer that included a

(16) A high sensitivity ZENK monoclonal antibody to map neuronal activity in AvesScientific ReportsDecember 1, 2020Gregory Charles Nordmann, Erich Pascal Malkemper, Lukas Landler, Lyubov Ushakova, Simon Nimpf, Robert Heinen, Stefan Schuechner, Egon Ogris, David Anthony Keaysbrain cDNA library was performed in two segments with the Phusion Hot Start Flex DNA polymerase (NEB, M0535S) using the following primer sequences: segment 1: Fwd: ATGGACACTCACTATCCCAA, Rev: GCAAACGCCTTAATAGTGG;

(17) Listeria Phages Induce Cas9 Degradation to Protect Lysogenic GenomesCell host & microbeJuly 8, 2020Osuna BA, Karambelkar S, Mahendra C, Christie KA, Garcia B, Davidson AR, Kleinstiver BP, Kilcher S, Bondy-Denomy J.Gibson Assembly Master Mix,New England Biolabs,Cat #E2611L Phusion Hot Start Flex DNA Polymerase,New England Biolabs,Cat #M0535S TURBO DNA-free Kit,Thermo Fisher Scientific,Cat #AM1907 Luna Universal One-Step RT-qPCR Kit,New England Biolabs

(18) Critical Anti-CRISPR Locus Repression by a Bi-functional Cas9 InhibitorCell Host & MicrobeJuly 1, 2020Beatriz A. Osuna, Shweta Karambelkar, Caroline Mahendra, Anne Sarbach, Matthew C. Johnson, Samuel Kilcher, Joseph Bondy-DenomyGibson Assembly Master Mix,New England Biolabs,Cat #E2611 L Phusion Hot Start Flex DNA Polymerase,New England Biolabs,Cat #M0535S Oligonucleotides,Oligonucleotides,Oligonucleotides Listeria reporter phage lysogen confirmation Primer1:

(19) A genome-wide association study reveals a novel regulator of ovule number and fertility in Arabidopsis thalianaPLOS GeneticsFebruary 11, 2019Jing Yuan, Sharon A. Kesslerfor primer sequences). For amplifying At3g60660 and At3g51050, PHUSION High-Fidelity Polymerase (NEB, M0535S) was used. All the PCR products were put into entry vector pDONR207 by BP reactions and then were recombined

(20) Specific structural elements of the T-box riboswitch drive the two-step binding of the tRNA ligandeLifeSeptember 25, 2018Jiacheng Zhang, Bhaskar Chetnani, Eric D Cormack, Dulce Alonso, Wei Liu, Alfonso Mondragón, Jingyi FeiT7 RNA polymerase PMID: 3684574 Peptide, recombinant protein BsaI New England Biolabs Catalgue #: M0535S Peptide, recombinant protein RppH New England Biolabs Catalgue #: M0356S Chemical compound, drug Cyanine5 NHS ester

Be the First to Write a Review!

Phusion Hot Start Flex DNA Polymerase

Phusion Hot Start Flex DNA Polymerase from New England Biolabs

New England Biolabs

Citations (22)

Reviews

Phusion Hot Start Flex DNA Polymerase from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map