Phusion Hot Start Flex 2X Master Mix M0536L from New England Biolabs

Product Specs
ItemPhusion Hot Start Flex 2X Master Mix
CompanyNew England Biolabs
Price $902.00 Inquire
Catalog NumberM0536L
Size500 reactions
ApplicationsDNA Analysis
TypeMaster Mix
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Multi-omics analysis of gut microbiota and metabolome reveals potential biomarkers in pediatric snoringBMC MicrobiologyMarch 12, 2026Xiaoyan Chen, Lihua Huang, Zhao Cheng, Ying Yang, Xiangjun Wan, Yan Xu, Shuaitong Chen, Lihua Zhourespectively. PCR amplification was performed with Phusion Hot Start Flex 2X Master Mix (catalog No. M0536L, NEB, USA), and custom-synthesized primers targeting the V3-V4 hypervariable region (341 F: 5′-CCTACGGGNGGCWGCAG-3′;

(2) Imaging the Intestinal Transcriptome With Multiplexed Error‐Robust Fluorescence In Situ Hybridization (MERFISH)Current ProtocolsDecember 27, 2025Paolo Cadinu, Evan Yang, Rosalind J. Xu, Brianna R. Watson, Josh Luce, Jeffrey R. MoffittBP2818500) Sera-Mag Carboxylated Beads (GE, 65152105050250) Phusion Hot Start Flex 2X Master Mix (NEB, M0536L) RNasin® Ribonuclease Inhibitors RNAsin Plus (VWR, N2615) Murine RNase inhibitor (NEB, M0314L) HiScribe™

(3) Effect of Biochar and Well-Rotted Manure on Maize Yield in Intercropping Systems Based on High-Throughput Sequencing TechnologyPlants (Basel)December 5, 2025Hui Liu, Wenlong Zhang, Wanyu Dou, Yutao Li, Guoxin Shi, Wei Peiall polymerase chain reactions (PCR) comprised 12.5 µL of Phusion® Hot Start Flex 2X Master Mix (NEB, M0536L), 2.5 µL of forward and reverse primers, 50 ng of DNA template, and 25 µL of ddH2O. The thermal cycling

(4) A genetic strategy to allow detection of F-actin by phalloidin staining in diverse fungimSphereOctober 29, 2025Alison C. E. Wirshing, Cristina Colino-Palomino, Analeigha V. Colarusso, Mario Pinar, Daniel J. LewLifeact-3×mCherry at URA3. All PCR fragments were amplified with Phusion Hot Start Flex 2× Master Mix (M0536L, NEB) following the manufacturer’s instructions, and the plasmids were built using NEBuilder HiFi DNA Assembly Master Mix

(5) The inconsistent pathogenesis of endometriosis and adenomyosis: insights from endometrial metabolome and microbiomemSystemsMay 20, 2025Chao Li, Xinxin Xu, Xiaojie Zhao, Bin Du(AGACGTGTGCTCTTCCGATCTAAGGCCCGGGAACGTATT). The amplification reaction was performed using Phusion Hot Start Flex 2× Master Mix (NEB, #M0536L), incorporating 50 ng of template DNA in a total volume of 25 µL. The amplification protocol included

(6) Characterization of the intestinal microorganism in patients with congenital intestinal atresia: the preliminary exploration for establishment and influence of initial intestinal flora in newbornsBMC MicrobiolMay 10, 2025Yang Chen, Ling Zhou, Qianghui Liao, Dong Xiao, Ledao Zhu, Jinlong Yao, Jiashu Liu, Xu'ning Zhang, Xiaopeng Ma, Feng Ren, et al.prepared, containing approximately 50 ng of template DNA, 12.5µL of Phusion Hot Start Flex 2X Master Mix (M0536L; NEB), 2.5µL of each primer and adequate water treated by diethylpyrocarbonate. PCR reactions were performed

(7) A genetic strategy to allow detection of F-actin by phalloidin staining in diverse fungibioRxivMay 6, 2025Alison C.E. Wirshing, Analeigha V. Colarusso, Daniel J. LewLifeact-3xmCherry at URA3. All PCR fragments were amplified with Phusion™ Hot Start Flex 2X Master Mix (M0536L, NEB) following the manufacturer’s instructions, and the plasmids were built using NEBuilder HiFi DNA Assembly Master Mix

(8) Allocation of resources among multiple daughter cellsbioRxivMay 6, 2025Alison C.E. Wirshing, Roberto Alonso-Matilla, Michelle Yan, Samra Khalid, Analeigha V. Colarusso, David Odde, Daniel J. Lew(Colarusso et al., 2025). All PCR fragments were amplified with Phusion™ Hot Start Flex 2X Master Mix (M0536L, NEB) following the manufacturer’s instructions, and plasmids were built using NEBuilder HiFi DNA Assembly Master Mix

(9) Cardiac Applications of CRISPR/AAV-Mediated Precise Genome EditingbioRxivDecember 7, 2024Yanjiang Zheng, Joshua Mayourian, Justin S. King, Yifei Li, Vassilios J. Bezzerides, William T. Pu, Nathan J. VanDuseninstructions. For each cDNA sample, 5ul of cDNA was amplified in duplicate Phusion Hot Start Flex (NEB M0536L) reactions, with a touchdown protocol for 15 cycles, decreasing 1°C per cycle from 70°C to 55°C annealing

(10) Generation of Barcode‐Tagged Vibrio fischeri Deletion Strains and Barcode Sequencing (BarSeq) for Multiplex Strain CompetitionsCurrent ProtocolsNovember 17, 2024Hector L. Burgos, Mark J. Mandelgene. Materials Nuclease-free Water (IDT, cat. no. 11–05-01–04) Phusion Hot Start Flex 2X Master Mix (NEB, cat. no. M0536L) Custom DNA oligonucleotides (IDT, cat. no. n/a) 1X TE (10 mM Tris-Cl, 0.1 mM EDTA, pH 8.0; IDT, cat.

(11) CIRCLE-Seq for Interrogation of Off-Target Gene EditingJournal of Visualized ExperimentsNovember 1, 2024Jeffrey Inen, Chann Makara Han, David M. Farrell, Ganna Bilousova, Igor KogutPX1 PEG/NaCl SPRI Solution,Kapa Biosystems,, Phusion Hot Start Flex 2x Master Mix,New England BioLabs,M0536L, Pierceable Foil Heat Seal,Bio-Rad,1814040, Plasmid-Safe ATP-dependent DNase,Epicentre,E3110K, "Primers,

(12) Neural network extrapolation to distant regions of the protein fitness landscapeNature CommunicationsJuly 30, 2024Chase R. Freschlin, Sarah A. Fahlberg, Pete Heinzelman, Philip A. Romeroamplified the oligonucleotide pool using either Phusion Hot Start Flex 2X Master Mix (New England Biolabs, #M0536L) or KAPA HiFi HotStart ReadyMix (Roche, #KK2602) (for: 5′-ACTCAAGGTCTCGCTA-3′; rev: 5′-GTCAAGGTCTCGGAT-3′),

(13) Deviations in RSV epidemiological patterns and population structures in the United States following the COVID-19 pandemicNature CommunicationsApril 20, 2024Estefany Rios-Guzman, Lacy M. Simons, Taylor J. Dean, Francesca Agnes, Anna Pawlowski, Arghavan Alisoltanidehkordi, Hannah H. Nam, Michael G. Ison, Egon A. Ozer, Ramon Lorenzo-Redondo, et al.generated cDNA was performed using the Phusion Hot Start Flex system (New England Biolabs, cat. no. M0536L). Genomic amplification was confirmed via agarose gel electrophoresis, followed by reaction pooling

(14) Inosine induces stemness features in CAR-T cells and enhances potencyCancer cellFebruary 12, 2024Klysz DD, Fowler C, Malipatlolla M, Stuani L, Freitas KA, Chen Y, Meier S, Daniel B, Sandor K, Xu P, et al.peptides, and recombinant proteins" Phusion Hot Start Flex 2X Master Mix,New England Biolabs,Cat# M0536L Cisplatin,Fluidigm,Cat# 201064 Fixable Viability Dye eFluorÔ 450,Thermo Fisher,Cat# 65-0863-18 Fixable

(15) Guinea pig herpes like virus is a gamma herpesvirusVirus GenesFebruary 10, 2024Brent A. Stanfield, Emmanuelle Ruiz, Vladimir N. Chouljenko, Konstantin G. Kousoulasreaction containing 10 ng of DNA. Phusion Hot-Start Flex 2 × Master Mix (New England Biolabs, Catalogue #: M0536L) was used and. Viral purification and DNA isolation GPHLV Strain LK40 was grown to high titer on Vero cells

(16) An Assessment of Human Opportunistic Pathogenic Bacteria on Daily Necessities in Nanjing City during Plum Rain SeasonMicroorganismsJanuary 26, 2024Xiaowei Yu, Yifan Yin, Zuoyou Wu, Hui CaorRNA gene V3-V4 PCR, containing 12.5 µL of Phusion® Hot Start Flex 2 X Master Mixart Version (NEB, M0536L, Beijing, China), 2.5 µL of Forward Primer (1 μM), 2.5 µL of Reverse Primer (1 μM), 50 ng of template

(17) Proteomic analysis of X-linked dystonia parkinsonism disease striatal neurons reveals altered RNA metabolism and splicingNeurobiology of DiseaseJanuary 1, 2024Kizito-Tshitoko Tshilenge, Joanna Bons, Carlos Galicia Aguirre, Cristian Geronimo-Olvera, Samah Shah, Jacob Rose, Akos A. Gerencser, Sally K. Mak, Michelle E. Ehrlich, D. Cristopher Bragg, et al.primers (Integrated DNA Technologies) and Phusion Hot Start Flex 2× Master Mix (New England Biolabs, M0536L) in a 50-μL total reaction. TAF1-intron 32 primers target exon 32 (Forward: 5′-ACATCTCCAAGCACAAGTATCA-3′)

(18) Single-cell epigenomics and spatiotemporal transcriptomics reveal human cerebellar developmentNature CommunicationsNovember 22, 2023Suijuan Zhong, Mengdi Wang, Luwei Huang, Youqiao Chen, Yuxin Ge, Jiyao Zhang, Yingchao Shi, Hao Dong, Xin Zhou, Bosong Wang, et al.pools (Twist Bioscience). We amplified the custom designed oligonucleotide pools by limited-cycle PCR (M0536L, NEB; 31000-T, Biotium). The amplified dsDNA was performed as templates for in vitro transcription started

(19) Unraveling Intestinal Microbial Shifts in ESRD and Kidney Transplantation: Implications for Disease-Related DysbiosisMicroorganismsNovember 10, 2023Pengpeng Yan, Sulin Luo, Luying Guo, Xingxia Wang, Xue Ren, Junhao Lv, Ying Chen, Xinyu Lin, Jianghua Chen, Rending Wangof 25 μL of the reaction mixture, which contained 12.5 μL of Phusion Hot Start Flex 2X Master Mix (#M0536L, NEB, Ipswich, MA, USA), 25 ng of template DNA, 2.5 μL of each primer, and appropriate PCR-grade water,

(20) Screening hydrogels for antifibrotic properties by implanting cellularly barcoded alginates in mice and a non-human primateNature Biomedical EngineeringApril 27, 2023Sudip Mukherjee, Boram Kim, Lauren Y. Cheng, Michael David Doerfert, Jiaming Li, Andrea Hernandez, Lily Liang, Maria I. Jarvis, Peter D. Rios, Sofia Ghani, et al.with a concentration of 50nM for each primer and Phusion Hot Start Flex 2X Master Mix (NEB, catalog #M0536L). The PCR reaction condition included an activation at 98°C for 30 sec, 20 cycles of denaturation at

Be the First to Write a Review!

Phusion Hot Start Flex 2X Master Mix

Phusion Hot Start Flex 2X Master Mix from New England Biolabs

New England Biolabs

Citations (40)

Reviews

Phusion Hot Start Flex 2X Master Mix from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map