Hot StartTaq2X Master Mix M0496S from New England Biolabs

Product Specs
ItemHot StartTaq2X Master Mix
CompanyNew England Biolabs
Price $65.00 Inquire
Catalog NumberM0496S
Size100 reactions
ApplicationsDNA Analysis
TypeMaster Mix
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Muscleblind-like proteins dimerize by forming disulfide bonds to regulate alternative splicing and pathogenic RNA foci formationbioRxivMarch 30, 2026Luke A. Knudson, Adam Kosti, Kathryn R. Moss, Liang Shi, GiaLinh N. Nguyen, Aleksandra Janusz-Kaminska, Eric X. Zhou, Ryan P. Hildebrandt, Eric T. Wang, Gary J. Bassellexcept RTB300 which was amplified 28 cycles, using Hot Start Taq 2x Master Mix (New England Biolabs, M0496S). The Wnk1 products were run on a 1% TBE agarose gel with SYBR Safe (Invitrogen, S33102), the Tcea2

(2) RNA innate immunity constitutes a barrier for interspecies chimerismCellJanuary 8, 2026Yingying Hu, Hai-Xi Sun, Masahiro Sakurai, Zhou Luo, Amanda E. Jones, Tianlei Cheng, Jia Huang, Lizhong Liu, Canbin Zheng, Jie Li, et al.protein,Takara Bio,#632678 Cy5-labelled GFP mRNA,OZ Biosciences,#MRNA11C Hot Start Taq 2x Master Mix,NEB,#M0496L NEBuilder® HiFi DNA Assembly Master Mix,NEB,#E2621L SYBR Green Master Mix,Qiagen,#330502 iScript™

(3) Defects in DNA damage signaling and cell cycle checkpoints in a mouse model of Rhno1 deletionCell Death DiscoveryDecember 19, 2025Joonyoung Her, Adithi Santhosh, Yanira Gonzalez-Rodriguez, Niphat Jirapongwattana, Channabasavaiah B. Gurumurthy, Adam R. Karpf, Samuel F. Buntingequivalent RT-PCR products produced using the primers as listed above with Hot Start Taq 2x Master Mix (M0496; NEB) under unsaturated conditions. Class switch recombination junction analysis For cloning of repair

(4) Multiplexed ultrasound imaging of gene expressionNature MethodsNovember 18, 2025Nivin N. Nyström, Zhiyang Jin, Marisa E. Bennett, Ruby Zhang, Margaret B. Swift, Mikhail G. Shapirolibrary construction and expression All PCR reactions were performed using the Taq Hot Start System (cat. no. M0496, NEB) and fragment insertion was conducted with the High Fidelity DNA Assembly System (cat. no. M0541,

(5) TYROSINASE-Deficient Human Retinal Pigment Epithelium Exhibits Melanosome Maturation DefectsInvest Ophthalmol Vis SciOctober 1, 2025Aman George, Tyler Pfister, Charles DeYoung, Ruchi Sharma, Mones Abu-Asab, Jizhong Zou, Kapil Bharti, Brian P. Brooksprimers 5’- GTTTGATGCTGGAGGTGGGA -3’ and 5’-TGGTCCCCAAAAGCCAAACT-3’ with Hot Start Taq 2X Master Mix (M0496; New England Biolabs, Ipswich, MA, USA) and Sanger sequenced (Eurofins Genomics, Ebersberg, Germany)

(6) TBK1 is involved in programmed cell death and ALS-related pathways in novel zebrafish modelsCell Death DiscovMarch 12, 2025Quentin Raas, Gregoire Haouy, Hortense de Calbiac, Elena Pasho, Anca Marian, Ida Chiara Guerrera, Marion Rosello, Patrick Oeckl, Filippo Del Bene, Alberto Catanese, et al.3’-GCTCGTCATGCTAACTCCACT-5’ For each sample, 2 μL of DNA was mixed with 10 μL of Hot Start Taq 2X Master Mix (NEB, M0496), 0.8 μL of each primer and 6.4 μL of sterile water. The PCR amplification program was optimized for

(7) A high-throughput protein tagging toolkit that retains endogenous untranslated regions for studying gene regulation in kinetoplastidsOpen BiolFebruary 26, 2025Carla Gilabert Carbajo, Xiaoyang Han, Bhairavi Savur, Arushi Upadhyaya, Fatima Taha, Michele Tinti, Richard J. Wheeler, Phillip A. Yates, Calvin Tiengweedited loci were performed in a 25 μl reaction volume using Hot Start Taq 2X Master Mix (NEB, cat. no. M0496). Five microlitres of all PCR reactions were resolved on a 1% agarose gel to verify the presence of

(8) Optimizing Yeast Homologous Recombination for Splicing Large Coronavirus Genome FragmentsInternational Journal of Molecular SciencesDecember 23, 2024Guoqing Xiong, Xuan Huang, Ao Hu, Zhixin Meng, Jiazhen Cui, Yuzhong Feng, Zhili Chen, Yuanyuan Lu, Qi Yang, Gang LiuμM) and 1.0 µL of downstream primer (10 μM), along with 25.0 µL of Hot Start Taq 2× Master Mix (NEB, M0496S, Ipswich, USA), 22.5 µL of nuclease-free water, and 0.5 µL of yeast cell lysis dilution. 4.5. Evaluation

(9) Human stem cell-specific epigenetic signatures control transgene expressionBiochimica et Biophysica Acta (BBA) - Gene Regulatory MechanismsDecember 1, 2024Chulhwan S. Kwak, Furkan E. Oflaz, Jiamin Qiu, Xinnan Wangprimers (sequences provided in the Table below), and 2xPCR master mix (M0492S, Q5 Polymerase, NEB or M0496L, HotStart Taq Polymerase, NEB) was incubated using the following thermocycling steps: 95 °C for 30 s,;

(10) Automating life science labs at the single-cell level through precise ultrasonic liquid sample ejection: PULSEMicrosystems & NanoengineeringNovember 20, 2024Peiran Zhang, Zhenhua Tian, Ke Jin, Kaichun Yang, Wesley Collyer, Joseph Rufo, Neil Upreti, Xianjun Dong, Luke P. Lee, Tony Jun Huangformat on a substrate and imaged under a microscope. Then, 400 nL of 0.89 × Taq-polymerase master mix (M0496, NEB, USA) was added to each spot of the cell-loaded substrate. Note that the concentration of the master

(11) Methanotrophic Communities and Cultivation of Methanotrophs from Rice Paddy Fields Fertilized with Pig-livestock Biogas Digestive Effluent and Synthetic Fertilizer in the Vietnamese Mekong DeltaMicrobes and EnvironmentsOctober 2, 2024Huynh Van Thao, Mitsunori Tarao, Hideshige Takada, Tomoyasu Nishizawa, Tran Sy Nam, Nguyen Van Cong, Do Thi Xuanfirst PCR product was prepared in a 25-μL mixture as follows: 12.5‍ ‍mL Hot Start Taq 2× Master Mix (M0496L; New England Biolabs); 0.5‍ ‍μL each of 10‍ ‍μmol L–1 A189f and mb661r primers; 5‍ ‍μL of template DNA

(12) Genome Sequence of Fowlpox Virus-Integrated Reticuloendotheliosis Virus from a Rio Grande Wild Turkey (Meleagris gallopavo intermedia )Microbiology Resource AnnouncementsJune 16, 2022Bianca Willis, Camille Trautman, Faith Cox, Tiffany Lujan, Jason Hardin, Robert Dittmar, Camila Romano, Jeff Brady, Dustin Edwardsisolate TSU-1029 contained an REV proviral genome insertion, PCR using Hot Start Taq 2× master mix (NEB; M0496L) and the heterologous primers REV env 7F and FPV 203 4R produced an appropriately sized 740-bp product

(13) NASP maintains histone H3-H4 homeostasis through two distinct H3 binding modesNucleic acids researchMay 20, 2022Bao H, Carraro M, Flury V, Liu Y, Luo M, Chen L, Groth A, Huang H.10 minutes. 2 μl of this lysate was directly used for PCR reactions with 2 × Taq start master mix (M0496L, NEB), and the two NASP clone screening primers (see primer table). Amplified DNA was sequenced using

(14) Reconstructing the Lineage Histories and Differentiation Trajectories of Individual Cancer Cells in Myeloproliferative NeoplasmsCell stem cellMarch 4, 2021Van Egeren D, Escabi J, Nguyen M, Liu S, Reilly CR, Patel S, Kamaz B, Kalyva M, DeAngelo DJ, Galinsky I, et al.previously. In Step 3, a 25uL PCR mixture was made containing 12.5uL of Hot Start Taq 2x Master Mix (NEB #M0496S), 1.25uL of cDNA additive (10x Genomics #220067), 1.25uL of forward primer (Partial P5, AATGATACGGCGACCACCGAGATCT)

(15) Nucleic acid detection aboard the International Space Station by colorimetric loop‐mediated isothermal amplification (LAMP)FASEB BioAdvancesMarch 1, 2020Julian Rubinfien et al.Q5 Hot Start High‐Fidelity 2X Master Mix (NEB M0494; New England Biolabs, Inc) or Hot Start Taq 2X Master Mix (NEB M0496; New England Biolabs, Inc), along with 5 μL primers prepared at 5 μmol/L concentration, 18 μL distilled

(16) Recovery of Renal Function following Kidney-Specific VEGF Therapy in Experimental Renovascular DiseaseAmerican journal of nephrologyJanuary 1, 2020Engel JE, Williams ML, Williams E, Azar C, Taylor EB, Bidwell GL, Chade AR.(Thermo Scientific, K1621). qPCR was performed using Hot Start Taq 2x Master Mix (New England BioLabs, M0496L). Samples were probed using primer pairs for Beta Actin (Hs01060665_g1), VEGF (Hs00900055_m1), KDR/Flk-1

(17) Metabolic Control of Astrocyte Pathogenic Activity via cPLA2-MAVSCellDecember 12, 2019Chao CC, Gutiérrez-Vázquez C, Rothhammer V, Mayo L, Wheeler MA, Tjon EC, Zandee SEJ, Blain M, de Lima KA, Takenaka MC, et al.DAPI Fluoromount-G,SouthernBiotech,Cat#0100–20 NuPAGE LDS sample buffer,Invitrogen,Cat#NP0007 Hot Start Taq 2X Master Mix,New England Biolabs,Cat#M0496 FuGENE HD Transfection Reagent,Promega,Cat#E2311 UK-5099,Tocris Bioscience,Cat#4186 methylglyoxal

(18) Demonstration of End-to-End Automation of DNA Data StorageScientific ReportsDecember 1, 2019Christopher N. Takahashi, Bichlien H. Nguyen, Karin Strauss, Luis Cezekilobase fragment that was PCR-amplified from the lambda genome using hot start TAQ DNA polymerase (NEB M0496) with a Bsa-I restriction site added by the forward primer. The resulting fragment after digestion had

(19) Aptamers in the Therapeutics and Diagnostics PipelinesTheranosticsJuly 1, 2018Harleen Kaur, John G. Bruno, Amit Kumar, Tarun Kumar Sharmaenzymes and other molecular biology reagents, has commercialized Hot Start Taq DNA polymerase (Cat No. M0496S and M0490S). Both of these products principally rely on an aptamer-based hot start technology to avoid

(20) Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal TransferJournal of BacteriologyApril 1, 2017Anthony W. Kingston, Christine Ponkratz, Elisabeth A. Raleigh(catalog number M0491; NEB), while diagnostic PCRs used the Hot Start Taq 2× master mix (catalog number M0496; NEB). Matings. Donor and recipient cultures were grown at 37°C to an optical density at 600 nm (OD600)

Be the First to Write a Review!

Hot StartTaq2X Master Mix

Hot StartTaq2X Master Mix from New England Biolabs

New England Biolabs

Citations (21)

Reviews

Hot StartTaq2X Master Mix from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map