T4 RNA Ligase 2, truncated KQ M0373L from New England Biolabs

Product Specs
ItemT4 RNA Ligase 2, truncated KQ
CompanyNew England Biolabs
Price $308.00 Inquire
Catalog NumberM0373L
Size10000 units
ApplicationsFunctional Genomics
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Mechanism of RACK1-dependent ZAKα activation at stalled and collided ribosomesMolecular CellJune 18, 2026Anna Constance Vind, José Francisco Martínez, Zhenzhen Wu, Andrii Bugai, Kelly Mordente, Giancarlo Abis, Sébastien Chamois, Sofia Ramalho, Catarina Pechincha, Laura Ryder, et al.adaptors containing a barcode and an 8N UMI were then ligated using T4 RNA Ligase 2 Deletion Mutant (NEB, #M0373L). Samples were multiplexed, and adaptor removal was performed for 1 h at 30 °C and 1 h at 37 °C by treating

(2) High-throughput functional profiling and evolutionary covariation analysis of entire riboswitch sequencesNucleic Acids ResJune 17, 2026Laura M Hertz, Anibal Arce, Elena Rivas, Julius B LucksSuperaseIn RNAse Inhibitor (Invitrogen, AM2696), 0.5 µl of T4 RNA ligase, and 0.5 µl of Trunc KQ (NEB, M0373L) was added and mixed by pipetting up and down 10 times. A master mix according to the number of samples

(3) Senescence modulated cardiac repair with pluripotent stem cell-derived cardiomyocytesStem Cell Research & TherapyJune 10, 2026Jian Zhao, Shin Kadota, Hajime Ichimura, Xiao Yang, Hotaka Kusabuka, Hideki Kobayashi, Yui Kitaori, Hidekazu Takahashi, Zouhour Guedi Omar, Ada Caruso, et al.(Universal miRNA Cloning Linker, New England Biolabs, S1315S) using T4 RNA Ligase 2, truncated KQ (New England Biolabs, M0373S), in the presence of 25% PEG 8000 and an RNase inhibitor (20 µL total; 25 °C, 16–24 h). The ligation

(4) Chromatin-associated intronic RNAs from long genes form introsomes that shape nuclear architecture in neuronal cellsbioRxivMay 30, 2026Wenjing Kang, Wing Hin Yip, Xiaoze Li-Wang, Quentin Verron, Britta A.M. Bouwman, Simona Pedrotti, Andrea Abou Yaghi, Mitsuyoshi Murata, Lorenzo Salviati, Erik Wernersson, et al.pre-adenylated RADICL-seq adapter to the RNA using T4 RNA Ligase 2, truncated KQ (New England BioLabs, cat. no. M0373L) at 20 °C overnight. The next day, we performed ligation of the adapter-ligated RNA to chromatin by

(5) SnoRNA Expression and RNA 2’-O-Methylation in Drosophila melanogaster S2 CellsbioRxivMay 26, 2026Xuan Ye, Yaling Liu, Sara Olson, Lijun Zhan, Gordon G. Carmichael, Brenton R. GraveleyRNA, 2 pL of a 3’-DNA linker (10 pM) and 4 pL of T4 RNA Ligase 2 truncated KQ (New England Biolabs, #M0373). The free 3’ DNA linkers from the ligation reactions were removed using 15% TBE-Urea gel. The gel was

(6) Spatial and genetic constraints govern transcription–translation coupling and mRNA degradation in bacteriaNature MicrobiologyMay 22, 2026Seunghyeon Kim, Yan Zhang, Xiangwu Ju, Albur Hassan, Yu-Huan Wang, Shixin Liu, Sangjin Kim3′ linker oligos (sequences listed below) using T4 RNA ligase 2 truncated KQ (New England Biolabs, M0373) at 16 °C overnight. 3′ linkers: /5rApp/NNNNNXXXXAGATCGGAAGAGCGTCGTGTAGGGAAAGA/3SpC3/ XXXX (4-base barcode):

(7) Retrovirus insertions in host transcripts trigger de novo piRNA immunityThe EMBO JournalMay 2, 2026Baptiste Rafanel, Liudmila Protsenko, Dominik Handler, Julius Brennecke, Kirsten-André SentiMonarch Genomic DNA Purification Kit,NEB,T3010L T4 RNA Ligase 1,NEB,M0204L "T4 RNA Ligase 2, truncated KQ",NEB,M0373L ZR small-RNA PAGE Recovery Kit,Zymo Research,R1070 Zymo RCC-5 Kit,Zymo Research,R1016 Zymoclean Gel DNA Recovery Kit

(8) Conserved but mechanistically diverse piRNA defence against endogenous retroviruses in insectsEMBO ReportsApril 2, 2026Shashank Chary, Patricia E Carreira, Sarah Nicholas, Kathryn B McNamara, Ian A Cockburn, Karin Nordström, Therésa M Jones, Rosalyn Gloag, Alyson Ashe, Leon E Hugo, et al.Biosciences,NU-1619-CY5 Terminal Deoxynucleotidyl Transferase,Thermo Fisher,EP0161 "T4 RNA Ligase 2, K227Q",New England Biolabs,M0373L T4 RNA Ligase 1,New England Biolabs,M0204S SuperScript II Reverse Transcriptase,Thermo Fisher,18064014 KAPA

(9) Exosome-mediated decay of unstable long extended precursors of human telomerase RNA is dependent on 5′-cap trimethylationGenes & DevelopmentApril 1, 2026Aniruddha Samajdar, Roberta Amato, Seongmoon Jo, Ethan Cordes, Albert Tai, Grazia Daniela Raffa, Luis F.Z. BatistaNEB S1315S, sequence: 5′-rAppCTGTAGGCACCATCAAT–NH2-3′) with 250 U of T4 RNA ligase-truncated KQ (NEB M0373S), 25% PEG 8000, and 1 µL of RNaseOUT (Invitrogen 10777019) in a 20 µL reaction for 16 h at 25°C. Ligated

(10) RNA functional modulation by Mitoxantrone via RNA structural ensemble repartitioningNature CommunicationsMarch 23, 2026Chundan Zhang, Ivana Borovská, Teona Iobashvili, Edoardo Morandi, Marta Lionnez, Oluwatosin S. Olayinka, Rinse de Boer, Massimiliano Clamer, Martin D. Witte, Klaus Pors, et al.Data 6), at 25 °C for 2 h, in a final volume of 20 μl, using 200 U T4 RNA Ligase 2, truncated KQ (cat. M0373L, New England Biolabs), in T4 RNA Ligase Reaction Buffer supplemented with 12.5% PEG-8000. Ligated RNA

(11) Multiplexed TrAEL-seq captures DNA replication dynamics in mammalian cellsNucleic Acids ResMarch 14, 2026Neesha Kara, Laura Biggins, Alex Whale, Kieron May, Vera Grinkevich, Paola Garran-Garcia, Jhanavi Srinivasan, Peter J Rugg-Gunn, Claudia Ribeiro de Almeida, Samantha J Walker, et al.8000, 1 µl 10 pM/µl TrAEL-seq adaptor 1 with multiplex index and 1 µl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml Tris buffer, transferred to individual 15 ml tubes and washed three

(12) Cell-free DNA methylome and fragmentome analysis for relapse monitoring of Ewing sarcomaEMBO Molecular MedicineMarch 6, 2026Sophie A Richardson, Aram Safrastyan, Mina Karimpour, Gayatri Gulati, Patrick J B Harker, Alan Redfern, Simon P Pearce, Vsevolod J Makeev, Bernadette Brennan, Alexander T J Lee, et al.Thermosensitive Phosphatase,Thermo Fisher,EF0654 "T4 RNA Ligase 2, Truncated KQ",New England Biolabs,M0373L KAPA HiFi HotStart PCR Kit,KAPA Biosystems (Roche),KK2502 / 7958897001 Invitrogen SuperScript IV Reverse Transcriptase

(13) Characterization of gRNA-dependent and gRNA-independent off-target binding sites of PspCas13b and RfxCas13d in mammalian cellsNucleic Acids ResearchFebruary 23, 2026Huanhuan Feng, Zhixue Li, Hongdao Zhang, Yuli Zheng, Beiying Xu, Yao Zhang, Lin Zou, Ligang Wu2.5 µl 3′ adapter (20 µM), 1 µl RiboLock RNase inhibitor, 1.5 µl T4 RNA Ligase 2, truncated KQ (NEB, M0373), 6 µl 50% PEG8000, 16 µl water] and incubated in a thermomixer at 25°C for 2.5 h with an intermittent

(14) Structural modification of oxazolidinone antibiotics alters nascent peptide stalling preference and peptide trajectory through the ribosomebioRxivFebruary 21, 2026Jordan I. Kleinman, Tushar Raskar, Dorota Klepacki, Teresa Szal, Nora Vázquez-Laslop, Alexander S. Mankin, James S. Fraser, Danica Galonić Fujimori50 μM Universal miRNA cloning linker (NEB S1315S) using 200 U of T4 RNA ligase 2 truncated KQ (NEB M0373L) for 3 h at 37°C. Ligated products of appropriate size range (32-62 nt) were isolated from 15% TBE Urea

(15) Step-by-Step Protocol for In Situ Profiling of RNA Subcellular Localization Using TATA-seqBio ProtocFebruary 20, 2026Xiao Jiang, Chu Xu, Lulu HuT4 polynucleotide kinase (NEB, catalog number: M0201L) 25. T4 RNA ligase 2 truncated KQ (NEB, catalog number: M0373) 26. M-MLV reverse transcriptase (Promega, catalog number: M1705) 27. NEBNext Ultra II Q5 master mix

(16) Step-by-Step Protocol for In Situ Profiling of RNA Subcellular Localization Using TATA-seqBIO-PROTOCOLFebruary 20, 2026Xiao Jiang, Chu Xu, Lulu HuT4 polynucleotide kinase (NEB, catalog number: M0201L) 25. T4 RNA ligase 2 truncated KQ (NEB, catalog number: M0373) 26. M-MLV reverse transcriptase (Promega, catalog number: M1705) 27. NEBNext Ultra II Q5 master mix

(17) Mechanistic insights into RNA chaperoning by Ro60 and La autoantigensCellFebruary 19, 2026Hyeyeon Nam, Justin C. Deme, Soyeong Sim, Marco Boccitto, Susan M. Lea, Sandra L. Wolinlibrary was prepared as described103, except that T4 RNA ligase 2 (truncated KQ) (New England Biolabs M0373S) was used for the first adaptor ligation and SuperScript III (Thermo Fisher 18080044) was used for reverse

(18) Coronaviruses reprogram the tRNA epitranscriptome to favor viral protein expressionNature CommunicationsFebruary 19, 2026Elena Muscolino, Mireia Puig-Torrents, Jaime Buigues Bisquert, Diogo Correa Mendonca, Marc Talló-Parra, Gemma Perez-Vilaro, Omar Caño-Prades, Gavin R. Meehan, Karen Kerr, Vanessa Herder, et al.with a 3’ dideoxycytidine) were ligated to the purified tRNA using T4 RNA ligase 2 truncated KQ (NEB M0373L), in a reaction containing 50% PEG-8000, T4 RNA ligase buffer (10X), and RNase inhibitor (SUPERase•In,

(19) Systematic Identification of Germ Granule Proteins Reveals Specialized Roles in RNAi and Small RNA InheritancebioRxivFebruary 1, 2026Shihui Chen, Lucas H. Prescott, Craig C. Mello, Carolyn M. Phillipspolyphosphatase (Epicenter RP8092H) and ligated to 3’ pre-adenylated adapters with Truncated T4 RNA ligase (NEB M0373L). Small RNAs were then hybridized to the reverse transcription primer, ligated to the 5’ adapter with

(20) Genome-wide profiling of RNA 2’-O-methylation in neurons and identification of orphan snoRNA targetsResearch SquareJanuary 20, 2026Gordon Carmichael, Xuan Ye, Yaling Liu, Yinzhou Zhu, Saran Alshawi, Brittany Elliott, Christopher Holley, Jean-Denis Beaudoin, Brenton R. Graveleyincubating for 30 minutes. A 3’-DNA linker was ligated to the RNA with T4 RNA ligase 2 truncated KQ (NEB, M0373S). Then a 5’-RNA linker was ligated to the RNA. The linker was denatured and then the ligation reaction

Be the First to Write a Review!

T4 RNA Ligase 2, truncated KQ

T4 RNA Ligase 2, truncated KQ from New England Biolabs

New England Biolabs

Citations (193)

Reviews

T4 RNA Ligase 2, truncated KQ from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map