qPCRBIO SyGreen® Blue Mix Separate-ROX PB20.17-05 from PCR Biosystems

Product Specs
ItemqPCRBIO SyGreen® Blue Mix Separate-ROX
CompanyPCR Biosystems
Price $276.00Supplier Page View Company Product Page
Catalog NumberPB20.17-05
Size500 x 20 µL reactions
ApplicationsqPCR, Relative Gene Expression Analysis, Absolute Quantification, Diagnostic qPCR, Detection of extremely low copy number targets, Crude sample PCR, High-throughput qPCR from Genomic, cDNA and Viral sequences
TypeEnzyme
Research AreaGenetics, Microbiology, Molecular Biology, Ecology, Oncology, Biomedical Science, Endocrinology, Virology, Parasitology, Immunology

Specifications/Features

Features:

Easy-to-see blue mix for greater pipetting precision and accuracy
Rapid extension rate for early Ct values
Market-leading sensitivity – increased limit of detection
Specific amplification from complex templates including GC-rich sequences
Non-PCR inhibiting intercalating dye
Compatible with all standard and fast cycling real-time instruments

Add to Compare List

PCR Biosystems

Aztec House

397-405 Archway Road

London N6 43R

United Kingdom

Phone: + 44 (0) 20 3936 8101

Email: info@pcrbio.com

Company Profile

Website: www.pcrbio.com

(1) Effects of Defined Pig Microbiota on Acute Salmonellosis in Gnotobiotic PigletsFASEB journal : official publication of the Federation of American Societies for Experimental BiologyJanuary 15, 2026Splichal I, Polakova K, Sinkora M, Neuzil Bunesova V, Modrackova N, Vlkova E, Kindlova Z, Horvathova K, Splichalova A.Real‐Time PCR A total of 1.2 μL of the PCR template was added to 10.8 μL of the qPCRBIO SyGreen Blue Mix (Cat# PB20.17–51, PCR Biosystems, London, UK) containing 500 nM each of the forward and reverse primers (Generi‐Biotech,

(2) Comparative study of rebaudioside A and rebaudioside Aα: physicochemical properties and in vivo metabolismnpj Science of FoodNovember 14, 2025Hye-Jin Kim, Hye-Jin Kang, Sangyi Lim, Ok Cheol Kim, Ki-Nam Yoon, Junhyeong Lee, Merc Emil Matienzo, Min-Jung Park, Bu-Soo Park, Jeong-Yong Cho, et al.Thermo Fisher Scientific) following the manufacturer’s protocol. qPCR was conducted using SYBR Green (PB20.17-51; PCR Biosystems, London, UK) on a QuantStudio 6 Flex 384-well qPCR System (Thermo Fisher Scientific),

(3) Rebaudioside D and M, the next-generation sugar substitutes, do not exacerbate metabolic dysfunction in high-fat diet miceFood Chemistry: XJuly 1, 2025Sangyi Lim, Min-Jung Park, Ki-Nam Yoon, Junhyeong Lee, Merc Emil Matienzo, Seong-Jin Hong, Keon Kim, Yeong-Bin Baek, Chang-Min Lee, Young-Min Kim, et al.according to the manufacturer's instructions. Quantitative PCR (qPCR) was performed using SYBR Green (#PB20.17–51; PCR Biosystems, London, UK) on a QuantStudio 6 Flex 384-well qPCR System (Thermo Fisher Scientific).

(4) Hypothalamic Median Eminence Thyrotropin-Releasing Hormone-Degrading Ectoenzyme Activity Is Dispensable for Basal Thyroid Axis Activity in Lean RodentsCellsMay 15, 2025Adair Rodríguez-Rodríguez, Rosa María Uribe, Antonieta Cote-Vélez, Patricia Joseph-Bravo, Jean-Louis CharliSybr® fast (Roche). For the anterior pituitary, qPCR reaction was performed using qPCRBIO SyGreen Mix (PB20.17, PCR Biosystems, Wayne, PA, USA). A Qiagen Rotor Gene Q thermocycler (Qiagen) was used. A posterior

(5) Helium cold atmospheric pressure plasma reduces erastin induced inflammation and ferroptosis in human gingival fibroblastsSci RepMarch 3, 2025Jung Sun Park, Young-Il Jeong, Byung-Hoon KimCorp., Madison, WI, USA). Real-time PCR was performed using qPCRBIO SyGreen Blue Mix Separate-ROX (PB20.17-05, PCR Biosystems Inc., Pennsylvania, USA) and CronoSTAR™ 96 Real-Time PCR System (640232, TaKaRa, Japan).

(6) Dysregulation of Leukaemia Inhibitory Factor (LIF) Signalling Pathway by Supraphysiological Dose of Testosterone in Female Sprague Dawley Rats During Development of Endometrial ReceptivityBiomedicinesJanuary 24, 2025Allia Najmie Muhammad Yusuf, Mohd Fariz Amri, Azizah Ugusman, Adila A Hamid, Izzat Zulhilmi Abd Rahman, Mohd Helmy Mokhtarreverse transcriptase (-RT). The qPCR master mix was prepared using the qPCRBio SyGreen Blue Mix Kit (CAT PB20.17-05, PCR Biosystems). One microliter of cDNA was used along with the glyceraldehyde-3-phosphate dehydrogenase

(7) Supraphysiological Dose of Testosterone Impairs the Expression and Distribution of Sex Steroid Receptors during Endometrial Receptivity Development in Female Sprague–Dawley RatsInternational Journal of Molecular SciencesSeptember 23, 2024Allia Najmie Muhammad Yusuf, Mohd Fariz Amri, Azizah Ugusman, Adila A Hamid, Mohd Helmy Mokhtar(-RT) served as a control. The qPCR master mix was prepared using the qPCRBio SyGreen Blue Mix Kit (CAT PB20.17-05 PCR Biosystems). The reference gene used in this study was glyceraldehyde-3-phosphate dehydrogenase

(8) Hypoxia inducible factors inhibit respiratory syncytial virus infection by modulation of nucleolin expressioniScienceJanuary 19, 2024Xiaodong Zhuang, Giulia Gallo, Parul Sharma, Jiyeon Ha, Andrea Magri, Helene Borrmann, James M. Harris, Senko Tsukuda, Eleanor Bentley, Adam Kirby, et al.assays ,, CytoTox 96 Non-Radioactive Cytotoxicity Assay,Promega,G1780 qPCRBIO SyGreen Blue Mix,PCR Biosystems Ltd,PB20.17-20 Firefly Luciferase Assay kit,Promega,E1501 ,, Experimental models: Cell lines,Experimental models:

(9) Molecular components of the circadian clock regulate HIV-1 replicationiScienceJuly 21, 2023Helene Borrmann, Görkem Ulkar, Anna E. Kliszczak, Dini Ismed, Mirjam Schilling, Andrea Magri, James M. Harris, Peter Balfe, Sridhar Vasudevan, Persephone Borrow, et al.CytoTox 96 Non-Radioactive Cytotoxicity Assay,Promega,G1780 cDNA Synthesis Kit,PCR Biosystems Ltd,PB30.11-10 qPCRBIO SyGreen Blue Mix,PCR Biosystems Ltd,PB20.17-20 Firefly Luciferase Assay kit,Promega,E1501 ,, Experimental models: Cell lines,Experimental models:

(10) Canine Mesenchymal-Stem-Cell-Derived Extracellular Vesicles Attenuate Atopic DermatitisAnimals : an open access journal from MDPIJuly 6, 2023Cho BS, Kim SB, Kim S, Rhee B, Yoon J, Lee JW.RT-PCR, in accordance with the instructions of the qPCRBIO SyGreen Blue Mix Separate-Rox (PCR Biosystems, PB20.17-05). The primer sequence is as follows. BMP2, F: CGGGAACAGATGCAGGAACC, R: AAAGTCTGGTCACGGGGAAC; RUNX2,

(11) Bone marrow adipose tissue is a unique adipose subtype with distinct roles in glucose homeostasisNature communicationsJune 18, 2020Suchacki KJ, Tavares AAS, Mattiucci D, Scheller EL, Papanastasiou G, Gray C, Sinton MC, Ramage LE, McDougald WA, Lovdel A, et al.1–4 μL of cDNA template. Sybr Green-based qPCR was done using qPCRBIO SyGreen Blue Mix (part number PB20.17-20; PCR Biosystems, UK). Taqman-based qPCR was done using qPCRBIO Probe Blue Mix (part number PB20.27-20,

(12) Effects of Testosterone on the Expression of Connexin 26 and Connexin 43 in the Uterus of Rats During Early PregnancyIn VivoMarch 26, 2020DATU AGASI MOHD KAMAL, SITI FATIMAH IBRAHIM, MOHD HELMY MOKHTAR(-RT) was used as a control. The qPCR master mix was prepared using qPCRBio SyGreen Blue Mix kit (CAT PB20.17-05 PCR Biosystems). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a reference gene. Specific

(13) An Oncolytic Virus Expressing a T-cell Engager Simultaneously Targets Cancer and Immunosuppressive Stromal CellsCancer researchDecember 15, 2018Freedman JD, Duffy MR, Lei-Rossmann J, Muntzer A, Scott EM, Hagel J, Campo L, Bryant RJ, Verrill C, Lambert A, et al.

(14) Development of Spermatogenesis In Vitro in Three-Dimensional Culture from Spermatogonial Cells of Busulfan-Treated Immature MiceInternational journal of molecular sciencesNovember 29, 2018AbuMadighem A, Solomon R, Stepanovsky A, Kapelushnik J, Shi Q, Meese E, Lunenfeld E, Huleihel M.

(15) Biofilm-Related Diseases and Omics: Global Transcriptional Profiling of Enterococcus faecium Reveals Different Gene Expression Patterns in the Biofilm and Planktonic CellsOmics : a journal of integrative biologyOctober 1, 2017Lim SY, Teh CSJ, Thong KL.

(16) Polycomb response elements reduce leaky expression of Cas9 under temperature-inducible Hsp70Bb promoter in Drosophila melanogaster"G3 (Bethesda, Md.)"January 1, 0001"Warsinger-Pepe N, Chang C, Desroberts CR, Akbari OS."(dT)18 primers. qPCR was performed using 2x qPCRBIO SyGreen Blue Mix Separate-ROX (PCR Biosystems #PB20.17) on a LightCycler® 96 Instrument (Roche). cDNA samples from 21°C rearing with 2 h heat-shock samples

Be the First to Write a Review!

qPCRBIO SyGreen® Blue Mix Separate-ROX

qPCRBIO SyGreen Blue Mix Separate-ROX

qPCRBIO SyGreen® Blue Mix Separate-ROX from PCR Biosystems

Description

Specifications/Features

PCR Biosystems

Citations (16)

Reviews

qPCRBIO SyGreen® Blue Mix Separate-ROX from PCR Biosystems

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map