qPCRBIO SyGreen® Mix Lo-ROX PB20.11-20 from PCR Biosystems

Product Specs
ItemqPCRBIO SyGreen® Mix Lo-ROX
CompanyPCR Biosystems
Price $929.00Supplier Page View Company Product Page
Catalog NumberPB20.11-20
Size2000 x 20 µL reactions
ApplicationsqPCR, Relative Gene Expression Analysis, Absolute Quantification, Diagnostic qPCR, Detection of extremely low copy number targets, Crude sample PCR, High-throughput qPCR from Genomic, cDNA and Viral sequences
TypeEnzyme
Research AreaGenetics, Microbiology, Molecular Biology, Ecology, Oncology, Biomedical Science, Endocrinology, Virology, Parasitology, Immunology

Specifications/Features

Features:

Rapid extension rate for early Ct values
Market-leading sensitivity – increased limit of detection
Specific amplification from complex templates including GC-rich sequences
Non-PCR inhibiting intercalating dye
Also available as an easy-to-see blue mix
Compatible with all standard and fast cycling real-time instruments

Add to Compare List

PCR Biosystems

Aztec House

397-405 Archway Road

London N6 43R

United Kingdom

Phone: + 44 (0) 20 3936 8101

Email: info@pcrbio.com

Company Profile

Website: www.pcrbio.com

(1) Toll-like receptors 7 and 8 can be targeted to enrich Y-chromosome sperm in the domestic dogReprod FertilFebruary 24, 2026Alexandra Shattock, Clara De Pascale, Fataneh Ghafari, John C W Hildyard, Richard J Piercy, Ali Fouladi-Nashtasorting. qPCR was conducted in 20 μL volumes, using qPCRBio SyGreen Mix Lo-ROX (PCR BioSystems, UK; PB20.11-05) with the appropriate primers added to a final concentration of 500 nM each. Reactions were performed

(2) Toll-like Receptors 7 and 8 can be targeted to enrich Y-chromosome sperm in the domestic dogReproduction and FertilityFebruary 24, 2026Alexandra Shattock, Clara De Pascale, Fataneh Ghafari, John C.W. Hildyard, Richard J. Piercy, Ali Fouladi-Nashtasorting. qPCR was conducted in 20 μL volumes, using qPCRBio SyGreen Mix Lo-ROX (PCR BioSystems, UK; PB20.11-05) with the appropriate primers added to a final concentration of 500 nM each. Reactions were performed

(3) A catecholamine-independent pathway controlling adaptive adipocyte lipolysisNature MetabolismJanuary 8, 2026Xiao Zhang, Sreejith S. Panicker, Jordan M. Bollinger, Anurag Majumdar, Rami Kheireddine, Lila F. Dabill, Clara Kim, Brian Kleiboeker, Fengrui Zhang, Yongbin Chen, et al.(Thermo Scientific, K1682) following the manufacturer’s instruction. 2× SyGreen Mix Lo-ROX (PCR Biosystems, PB20.11–51) was used to perform the qPCR assay on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific,

(4) Cannabidiol Protects the Neonatal Mouse Heart from Hyperoxia-Induced InjuryInternational Journal of Molecular SciencesDecember 23, 2025Teresa Hellberg, Thomas Schmitz, Christoph Bührer, Stefanie EndesfelderSupplementary Table S1, was executed using the qPCRBIO SyGreen Mix Lo-ROX (PCR Biosystems, London, UK, Cat. PB20.11) on a QuantStudio™ 5 Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific Inc., Waltham,

(5) Enhanced hybridization-proximity labeling discovers protein interactomes of single RNA moleculesNature communicationsOctober 20, 2025Yap K, Chung TH, Hedges EC, Nishimura AL, Shaw CE, Makeyev EV.performed in 20 μl reactions containing 10 μl of qPCRBIO SyGreen Master Mix Lo-ROX (PCR Biosystems, cat# PB20.11-51), 5 μl of diluted cDNA, and 100 nM of each primer. The following primer pairs were used: C9orf72 expression analysis

(6) Transcriptomic analysis of iPSC-derived endothelium reveals adaptations to high altitude hypoxia in energy metabolism and inflammationPLoS GenetFebruary 10, 2025Olivia A. Gray, David B. Witonsky, Jordan Jousma, Débora R. Sobreira, Alexander Van Alstyne, Ru-Ting Huang, Yun Fang, Anna Di RienzoRT-qPCR performed on a QuantStudio 6 Flex machine using qPCRBIO SyGreen Blue Mix Lo-ROX (PCR Biosystems, PB20.11-05). RT-qPCR was used to identify the production of endogenous pluripotency factors (OCT3/4, SOX2, KLF4,

(7) Identification and validation of Novel Estrogen Biosynthesis Biomarkers in Sinonasal Inverted PapillomaInternational Journal of Medical SciencesJanuary 1, 2025Yi-Fang Yang, Sung-Huan Yu, Jia-Bin Liao, Yu-Hsuan Linsynthesize cDNA. Real-time PCR was performed using qPCR BIO SyGreen Mix Lo-ROX SYBRTM Green PCR Master Mix (#PB20.11-01, PCR BIOSYSTEMS, U.S.A) to evaluate target gene expression. The primers used included: AKR1B10-F: GCAACGTTCTTGGATGCCTG;

(8) Recurrent disruption of tumour suppressor genes in cancer by somatic mutations in cleavage and polyadenylation signalseLifeDecember 11, 2024Yaroslav Kainov, Fursham Hamid, Eugene V Makeyeva Light Cycler96 Real-Time PCR System (Roche) and qPCR BIO SyGreen Master Mix (PCR Biosystems, cat# PB20.11–51). The RT-qPCR signals downstream of the XPA cleavage site (MLO944, 5'-GGCCGCGACTCTAGATCATAA-3' and MLO358,

(9) Recurrent disruption of tumour suppressor genes in cancer by somatic mutations in cleavage and polyadenylation signalsElifeDecember 11, 2024Yaroslav Kainov, Fursham Hamid, Eugene V Makeyeva Light Cycler96 Real-Time PCR System (Roche) and qPCR BIO SyGreen Master Mix (PCR Biosystems, cat# PB20.11–51). The RT-qPCR signals downstream of the XPA cleavage site (MLO944, 5'-GGCCGCGACTCTAGATCATAA-3' and MLO358,

(10) C9orf72 poly-PR forms anisotropic condensates causative of nuclear TDP-43 pathologyiScienceOctober 18, 2024Hodgson RE, Rayment JA, Huang WP, Sanchez Avila A, Ellis BCS, Lin YH, Soni N, Hautbergue GM, Shelkovnikova TA.11668027 M-MLV Reverse Transcriptase,Promega,Cat# M1701 qPCRBIO SyGreen Mix Lo-Rox,PCR Biosystems,Cat# PB20.11–05 JetPRIME Transfection Reagent,PolyPlus,Cat# 101000027 GenElute™ Mammalian Total RNA Miniprep Kit,Sigma-Aldrich,Cat#

(11) Central activation of catecholamine-independent lipolysis drives the end-stage catabolism of all adipose tissuesbioRxiv : the preprint server for biologyJuly 31, 2024Zhang X, Majumdar A, Kim C, Kleiboeker B, Magee KL, Learman BS, Thomas SA, Lodhi IJ, MacDougald OA, Scheller EL.(Thermo Scientific, K1682) following the manufacturer’s instruction. SyGreen 2×Mix Lo-ROX (PCR Biosystems, PB20.11–51) was used to perform the qPCR assay on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific,

(12) PARP14 Contributes to the Development of the Tumor-Associated Macrophage PhenotypeInternational Journal of Molecular SciencesMarch 22, 2024Isotta Sturniolo, Csongor Váróczy, Zsolt Regdon, Anett Mázló, Szabolcs Muzsai, Attila Bácsi, Giorgia Intili, Csaba Hegedűs, Mark R. Boothby, Jacob Holechek, et al.Kit (4668814) was from Applied Biosystems (Foster City, CA, USA), and 2× qPCRBIO Sygreen Mix Lo-ROX (PB20.11-50) was from PCR Biosystems (London, UK). Oligonucleotides were purchased from IDT (Coralville, IA, USA)

(13) Sarm1 knockout prevents type 1 diabetic bone disease in females independent of neuropathyJCI InsightJanuary 4, 2024Jennifer M. Brazill, Ivana R. Shen, Clarissa S. Craft, Kristann L. Magee, Jay S. Park, Madelyn Lorenz, Amy Strickland, Natalie K. Wee, Xiao Zhang, Alec T. Beeve, et al.11766050). Quantitative real-time PCR was performed with qPCRBIO SyGreen Mix Lo-Rox (PCR Biosystems PB20.11-51) according to manufacturer instructions. Primers were as follows: Sarm1 (forward: CTTCGCCAGCTACGCTACTTGC,

(14) Protocol for auxin-inducible depletion of the RNA-binding protein PTBP1 in mouse embryonic stem cellsSTAR ProtocolsDecember 1, 2023Yaroslav Kainov, Anna Zhuravskaya, Eugene V. Makeyev18090200 PCRBIO HS Taq mix red,PCR Biosystems,Cat# PB10.23-02 qPCRBIO SyGreen mix,PCR Biosystems,Cat# PB20.11-51 GeneRuler 1 kb Plus DNA ladder,Thermo Fisher Scientific,Cat# SM1331 RIPA lysis buffer system,Santa Cruz Biotechnology

(15) A pleiotropic hypoxia-sensitive EPAS1 enhancer is disrupted by adaptive alleles in TibetansScience AdvancesNovember 25, 2022Olivia A. Gray, Jennifer Yoo, Débora R. Sobreira, Jordan Jousma, David Witonsky, Noboru J. Sakabe, Ying-Jie Peng, Nanduri R. Prabhakar, Yun Fang, Marcelo A. Nobréga, et al.was performed on a QuantStudio 6 Flex machine using qPCRBIO SyGreen Blue Mix Lo-ROX (PCR Biosystems, PB20.11-05). Primers used are listed in table S16. Because hypoxia is an extreme stress on cells and causes a global

(16) Septin7 is indispensable for proper skeletal muscle architecture and functioneLifeAugust 5, 2022Gönczi M, Ráduly Z, Szabó L, Fodor J, Telek A, Dobrosi N, Balogh N, Szentesi P, Kis G, Antal M, et al.kit,Thermo Fisher Scientific,Cat# EN0521, Commercial assay or kit,SYBRGreen mix,PCR Biosystems,Cat# PB20.11-51, Commercial assay or kit,High-specificity TaqMan assays,Thermo Fisher Scientific,Cat# 4331182, Commercial

(17) A mind in motion: Exercise improves cognitive flexibility, impulsivity and alters dopamine receptor gene expression in a Parkinsonian rat modelCurrent Research in NeurobiologyMay 1, 2022Wang Zhuo, Adam J. Lundquist, Erin K. Donahue, Yumei Guo, Derek Phillips, Giselle M. Petzinger, Michael W. Jakowec, Daniel P. Holschneideral., 2019, 2021). Briefly, qRT-PCR was run with 2 μl of cDNA and qPCRBIO SyGreen master mix (Cat. No. PB20.11–01, PCR Biosystems) on an Eppendorf Mastercycler Ep Realplex (Eppendorf, Hauppauge, NY, USA) using a program

(18) Generation and analysis of innovative genomically humanized knockin SOD1, TARDBP (TDP-43), and FUS mouse modelsiScienceDecember 17, 2021Devoy A, Price G, De Giorgio F, Bunton-Stasyshyn R, Thompson D, Gasco S, Allan A, Codner GF, Nair RR, Tibbit C, et al.,Applied biosystems,4368814 qScript cDNA Synthesis,Quanta Bio,95047-500 qPCR Bio SyGreen mix LO-ROX,PCR Biosystems,PB20.11-05 Dream taq green PCR master mix (2X),Thermo Scientific,K1081 Fast SYBR Green Master Mix,ThermoFisher,4385610 DC

(19) A bone-specific adipogenesis pathway in fat-free mice defines key origins and adaptations of bone marrow adipocytes with age and diseaseeLifeAugust 11, 2021Xiao Zhang, Hero Robles, Kristann L Magee, Madelyn R Lorenz, Zhaohua Wang, Charles A Harris, Clarissa S Craft, Erica L Scheller(Thermo Fisher Scientific 11766050) according to the manufacturer’s instruction. SyGreen 2 × Mix Lo-ROX (PCR Biosystems PB20.11–51) was used to perform the qPCR assay on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific

(20) A bone-specific adipogenesis pathway in fat-free mice defines key origins and adaptations of bone marrow adipocytes with age and diseaseElifeAugust 11, 2021Xiao Zhang, Hero Robles, Kristann L Magee, Madelyn R Lorenz, Zhaohua Wang, Charles A Harris, Clarissa S Craft, Erica L Scheller(Thermo Fisher Scientific 11766050) according to the manufacturer’s instruction. SyGreen 2 × Mix Lo-ROX (PCR Biosystems PB20.11–51) was used to perform the qPCR assay on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific

Be the First to Write a Review!

Related Products

Item	Catalog Number	Get Quote
qPCRBIO SyGreen® Mix Lo-ROX	PB20.11-51	Supplier Page
qPCRBIO SyGreen® Blue Mix Separate-ROX	PB20.17-51	Supplier Page
qPCRBIO SyGreen® Mix Lo-ROX	PB20.11-05	Supplier Page
qPCRBIO SyGreen® Mix Hi-ROX	PB20.12-20	Supplier Page
qPCRBIO SyGreen® Mix Hi-ROX	PB20.12-01	Supplier Page
qPCRBIO SyGreen® Mix Fluorescein	PB20.13-20	Supplier Page
qPCRBIO SyGreen® Mix Separate-ROX	PB20.14-20	Supplier Page
qPCRBIO SyGreen® Blue Mix Lo-ROX	PB20.15-05	Supplier Page
qPCRBIO SyGreen® Blue Mix Lo-ROX	PB20.15-20	Supplier Page
qPCRBIO SyGreen® Blue Mix Separate-ROX	PB20.17-50	Supplier Page