BsmBI-v2 R0739L from New England Biolabs

Product Specs
ItemBsmBI-v2
CompanyNew England Biolabs
Price $324.00 Inquire
Catalog NumberR0739L
Size1000 units
ApplicationsDNA Manipulation
TypeRestriction Enzyme
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) LINE-1 Locus Transcription Nucleates Oncogenic Chromatin ArchitectureCancer DiscoveryApril 1, 2026Michael Lee, Yuannyu Zhang, Jun Yi Stanley Lim, Tao Dai, James Ye, Margaret B. Cervantes, Varun Sondhi, Sisi Zheng, Yoon Jung Kim, Brandon Chen, et al.cooling to 22°C at −0.1°C/s. Golden Gate reactions were performed with BsmBI-v2 (New England Biolabs, R0739L) and T4 DNA ligase (New England Biolabs, M0202L) by cycling 30 times between a digestion-predominant

(2) 5-Azacytidine incorporation into mRNAs disrupts translation and induces ribosome collisionsbioRxivMarch 31, 2026Alexis B Roberson, James Marks, Ruby Pitts, Bavavarshini Tamilselvam, Brian Grieb, William P Tansey, Sezen MeydanlentiGuide-Puro75 (Addgene plasmid # 52963) plasmid was digested using BsmB1-v2 restriction enzyme (NEB, R0739) and Buffer r3.1 (NEB, B6003), dephosphorylated by using CIP (NEB, M0525), and then gel purified. The

(3) circOMA1 delivered by exosomes regulates DRD2‑mediated prolactinoma resistanceInternational Journal of Molecular MedicineMarch 26, 2026Qing Rao, Dimin Zhu, Zongming Wang, Shaolin Zhang, Xueli Li, Shashikiran Tagilapalli, Nan Wang, Weiyu Hu, Wenli Chen, Yonghong Zhuvector (cat. no. 52961; Addgene, Inc.), linearised by restriction endonuclease using BsmBI (cat. no. R0739; New England BioLabs, Inc.) using T4 ligase. 293T cells were plated in a 10-cm culture dish and cultured

(4) A critical signaling role for diacylglycerol in phagocytosis of M. tuberculosisbioRxivMarch 26, 2026Alec Griffith, Michelle Garcia, Gaelen Guzman, Fikadu G. Tafesselab25. The empty lentiCRISPRv2 plasmid was digested with FastDigest BsmBI (New England Biolabs, product R0739S) and dephosphorylated with rSAP (New England Biolabs, product M0371S) overnight at 37 °C. Digested plasmids

(5) APC coordinates GSK3 phosphorylation of SETD8 to suppress colorectal cancerCell ReportsMarch 24, 2026Zvi Cramer, Keara Monaghan, Ricardo Petroni, Xin Wang, Stephanie Adams-Tzivelekidis, Kayla Durning, Melissa S. Kim, Yuhua Tian, Nicolette M. Johnson, María F. Carrera Rodríguez, et al.competition assays and phosphomutant rescue experiments, LRG and LentiCRISPRV2 were digested with BsmBI (NEB #R0739S) and ligated with annealed sgRNA oligos targeting Setd8 exon 8. The sgRNA target sequences used included:

(6) A comparative analysis of CD70-directed CAR-T cells for glioblastoma treatment demonstrates a superior efficacy of the ligand-based constructMolecular Therapy OncologyMarch 19, 2026Alexandros Kourtesakis, Hiu Nam Hannah Chow, Eileen Bailey, Sandra Horschitz, Ammar Jabali, Rainer Will, Christoph Schifflers, Abigail K. Suwala, Hannah Rohdjess, Melissa Hahn, et al.Then, the oligonucleotides were inserted into the LentiCRISPRv2GFP vector by digestion with BsmbI-v2 (#R0739S, New England Biolabs) and ligation using T4 DNA ligase (#M0202S, New England Biolabs). Ligation products

(7) A CRISPR-Cas13d cancer therapeutic enables selective elimination of uveal melanomaMolecular Therapy OncologyMarch 19, 2026Daniel Stauber, Lucas Sosnick, Yitong Ma, Sopida Pimcharoen, Atip Lawanprasert, Niren Murthy, David Myung, Lei S. Qioligonucleotides (IDT) and cloned into a previously published pU6-RfxCas13d-crRNA plasmid via BsmBI (NEB, #R0739)64; all inserts were sequence-verified. The plasmid used for Cas9 knockout of RasGRP3 was cloned by

(8) TBXA2R activates ERMs to drive motility, invasion, and metastatic colonization of TNBC cellsLife Sci AllianceMarch 17, 2026Kévin Leguay, Omaima Naffati, Camila Lie Kiyan, Yu Yan He, Mireille Hogue, Chloé Tesnière, Melania Gombos, Hellen Kuasne, Louis Gaboury, Christian Le Gouill, et al.following sequence guides were inserted in plentiCRISPR-v2 (#52961; Addgene) digested with BsmBI (#R0739; New England Biolabs): EZR (CTGAGCGGCTGATCCCTCAA), RDX (GTTTCACTTACCGCTGGGGT), MSN#1 (GAGACAAGTTGCTCCCGCAG),

(9) Spatial tumor evolution panorama of ovarian cancerCell Rep MedMarch 17, 2026Chenzhao Feng, Yunyi Yang, Guanchu Li, Zixuan Fang, Bin Yang, Fang Zhao, Xingyu Chen, Shuyi Liu, Di Wu, Xingyuan Hu, et al.sgRNA sequences were cloned into a single vector. lentiCRISPR v2 vector was digested with BsmBⅠ (NEB, R0739S), then remove enzyme and smaller band by Gel DNA Extraction Kit (Vazyme, DC301-01). An additional U6

(10) Biophysical trade-offs in antibody evolution are resolved by conformation-mediated epistasisbioRxivMarch 16, 2026Cole R. Tharp, Claudio Catalano, Anthony Khalifeh, Sam Ghaffari-Kashani, Ruimin Huang, Gyunghoon Kang, Giovanna Scapin, Angela M. Phillipsregion). Fragments were designed as described previously55, each flanked by BsmbI (New England Biolabs #R0739L) sites and unique 4-bp overlaps to ensure correct assembly and were generated by PCR using Q5 polymerase

(11) Integrative analysis of mRNA stability regulation uncovers a metastasis-suppressive program in breast cancerSci AdvMarch 13, 2026Heather Karner, Tabea C. Mittmann, Vicky W. Chen, Ashir A. Borah, Andreas Langen, Hassan Yousefi, Lisa Fish, Balyn W. Zaro, Albertas Navickas, Hani Goodarzitwo-step cloning first with BstXI (NEB, R0113S) and BlpI (NEB, R0585S) and second with BsmBI-v2 (NEB, R0739S). The sgRNA sequences were selected from (36). See table S5 for sgRNA target sequences. The two-step

(12) RNA localization to nuclear speckles follows splicing logicNucleic Acids ResMarch 6, 2026Li Wen, Mauricio A Arias, Xinqi Fan, Joyce Xie, Sneha Paul, Susan E Liao, Marek Sobczyk, Oded Regev, Jingyi Feicontaining SR, HN, and a control sequence downstream of a T7 promoter were digested with BsmBI-v2 (NEB, R0739) and used as templates for in vitro transcription. RNA was synthesized using T7 polymerase (NEB, M0251SVIAL)

(13) CRISPR-based functional genomics for dissecting therapeutic dependency in primary acute myeloid leukemia samplesMolecular CellMarch 5, 2026Zhendong Cao, Sixiang Yu, Jacqueline Peng, Declan R. Barrett, Yuqiao Liu, Jonathan H. Sussman, Changya Chen, Anusha Thadi, Li Liu, Fatemeh Alikarami, et al.Alt-R™ S.p. Cas9 Nuclease V3,IDT,Cat # 1081058 Alt-R® Cas9 Electroporation Enhancer,IDT,Cat # 1075915 BsmBI-v2,NEB,Cat # R0739S Methylcellulose-based medium with recombinant cytokines for human cells,STEMCELL Technology,Cat # H4434 T4 DNA ligase

(14) LYPLAL1 Rare Loss-of-Function Variants in Humans and Deletion in Human Hepatoma Cells Protect Against MASLDJournal of Lipid ResearchMarch 3, 2026Rawdat Hussain, Chinmay Raut, Ponnandy Prabhu, Akram Irshaid, Yash Hegde, Yue Chen, Asmita Pant, Antonino Oliveri, Xiaochao Wei, Lishi Yin, et al.as described previously (36). Briefly, the vector was digested with BsmBI-V2 (New England Biolabs, #R0739S). The single guide oligo pair used for LYPLAL1 was: 5′-CACCGATTGAAAGCTCCTCAGAGAG-3′ and 5′-AAACCTCTCTGAGGAGCTTTCAATC-3′.

(15) MYC-ATF4-ASS1 axis governs intracellular arginine synthesis and dictates the immune microenvironment in melanomabioRxivMarch 2, 2026Haiwei Mou, Veronika Yakovishina, Yeqing Chen, Min Xiao, Maggie Dunne, Nancy Shi, Monzy Thomas, Kristen DeRosa, Haiyin Li, Qin Liu, et al.annealed and ligated into a lentiCRISPRv2-blasticidin backbone (Addgene, 98293) cut with BsmBI-v2 (NEB, R0739S). The ligation product was diluted 1:50, transformed into One Shot Stbl3 competent cells (Invitrogen,

(16) Ribosomal protection as a linezolid resistance mechanism in Mycobacterium abscessusAntimicrobial Agents and ChemotherapyMarch 2, 2026Tobias Funck, Kerry McGowen, Mark R. Sullivan, Samuel Zinga, Ian D. Wolf, Dennis Nurjadi, Claudia M. Denkinger, Eric J. Rubinplasmid 166,886 as previously described (33). Briefly, plasmid 166,886 was digested with BsmBI-v2 (NEB R0739L) and then gel-purified. Three sgRNAs were designed to target three different locations of the non-template

(17) Context-specific Angiogenin-mediated tRNA fragments (tDRs) biogenesis shapes the mitochondrial stress responseRedox BiologyMarch 1, 2026Shadi Al-Mesitef, Daisuke Ando, Tomoya Saigasaki, Yuki Sakaguchi, Shunya Akagi, Abdulrahman Mousa, Sherif Rashad, Kuniyasu Niizumaprotocol with slight modifications [34]. The lentiCRISPR-v2 vector was digested by BsmBI-v2 (NEB, Cat# R0739L) and dephosphorylated by Quick CIP (NEB, Cat# M0525S). Then, the synthesized phosphorylated oligos were

(18) Breaking β-sheets in FUS prion-like domain preserves phase separation and function but prevents aggregation and toxicitybioRxivFebruary 25, 2026Noah Wake, Juan Alcalde, Daniel Jutzi, Anjali Bajaj, Sukhleen Kour, Mayur Barai, Shuo-Lin Weng, Samara Cummings, Tongyin Zheng, Eric N. Anderson, et al.pcDNA6F-12P-hsFUS was generated by digesting pcDNA6F-hsFUS with XhoI (NEB, #R0146) and BmgBI (NEB, #R0739) and replacing the excised XhoI-BmgBI fragment with a gene-synthesized (GeneArt, Life Technologies)

(19) Scalable TCR synthesis and screening enables antigen reactivity mapping in vitiligoImmunityFebruary 10, 2026Stephanie A. Gaglione, Rachit S. Mukkamala, Chirag Krishna, Blake E. Smith, Marc H. Wadsworth, Scott A. Jelinsky, Caleb R. Perez, Laura Schmidt-Hong, Erica L. Katz, Kyle J. Gellatly, et al.(BsmBI-v2),NEB,Cat#E1602 NEBridge Golden Gate Assembly Kit (BsaI-HF-v2),NEB,Cat#E1601 BsaI-HF-v2,NEB,Cat#R3733 BsmBI-v2,NEB,Cat#R0739 BbsI-HF,NEB,Cat#R3539 SapI,NEB,Cat#R0569 FastDigest XbaI,ThermoFisher,Cat#FD0685 FastDigest Buffer,ThermoFisher,Cat#B64 Nuclease-free water (not DEPC-treated

(20) Multiplexed enrichment and tracking of lineages with CloneSweeperbioRxivJanuary 31, 2026Robert J. Vander Velde, Raymond W.S. Ng, Christopher Coté, Sydney M. ShafferGGCCCTCTCTGGGTCCCCATGTACTCTGCGTTGATACCACTGCTTCCCTCGGGGTTGGGAGGTGG. We then linearized the plasmid using BsmBI-v2 (NEB R0739S). We extracted linearized plasmid from agarose gel using a Qiagen gel extraction kit (28704); we eluted

Be the First to Write a Review!

BsmBI-v2

BsmBI-v2 from New England Biolabs

New England Biolabs

Citations (241)

Reviews

BsmBI-v2 from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map