BbsI-HF R3539S from New England Biolabs

Product Specs
ItemBbsI-HF
CompanyNew England Biolabs
Price $75.00 Inquire
Catalog NumberR3539S
Size300 units
ApplicationsDNA Manipulation
TypeRestriction Enzyme
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) An Episomal Clustered Regularly Interspaced Short Palindromic Repeats/Cas9 System for Transgene-Free Multiplex Gene Editing in Pig CellsBiology (Basel)May 8, 2026Chaoqian Jiang, Dongyan Yang, Chengbo Sun, Xingrui Ren, Tianze Li, Jiayan Wu, Jian Tian, Mingjie Feng, Yuchang Yao, Jun Song, et al.To facilitate the subsequent insertion of sgRNA, the vector was digested at the BbsI (NEB Cat. No. R3539S, Ipswich, MA, USA) restriction site. To carry out functional verification experiments, a control plasmid

(2) Chromosomal instability promotes cell migration and invasion via EFEMP1 secretion into extracellular vesiclesThe EMBO JournalApril 13, 2026Siqi Zheng, Ruifang Tian, Marsudi Siburian, Anna Haider Rubio, Yuanyuan Liu, Rene Wardenaar, Marjan Shirzai, Laura Kempe, Emma Dijkstra, Eliza Warszawik, et al.gel/Matrigel,Corning,356234 Doxycycline,Sigma-Aldrich,D9891 Proteinase K,Roche,Lot 30032017 BbsI,NEB,R3539S AgeI,NEB,R3552 EcoRI,NEB,Cat# R0101 Polybrene,Sigma-Aldrich,Cat# 107689 0.45 µm filter,TPP,Y99745 RNeasy

(3) Essentialome-Wide Multigenerational Imaging Reveals Mechanistic Origins of Cell Growth LawsbioRxivApril 12, 2026Daniel S. Eaton, Carlos Sánchez, Luis Gutiérrez-López, Jacob Q. Shenker, Youlian Goulev, Brianna R. Watson, Véronique Henriot, Ethan C. Garner, Quincey A. Justman, Jeffrey R. Moffitt, et al.was purified (Monarch PCR & DNA Cleanup Kit, T1030S) and subsequently digested using BbsI-HF (NEB, R3539S) for 30 mins at 37 °C. 1 μL of 5M NaCl to condition the buffer for a subsequent digestion with BsmBI-v2

(4) CBP-IDRs regulate acetylation and gene expressionCell RepMarch 24, 2026Katie L. Gelder, Nicola A. Carruthers, Grace Gilbert, Laura J. Harrison, Brychan V. Evans, Thomas I. Evans, Sophie S. Ball, Mark Dunning, Timothy D. Craggs, Alison E. Twelvetrees, et al.Phosphatase (CIP),NEB,M0525S BamHI-HF,NEB,R3136S MluI-HF,NEB,R3198S BssHII,NEB,R0199S BbsI-HF,NEB,R3539S QuickExtract solution,Lucigen,QE0905T T7 Endonuclease 1 (T7E1) enzyme,NEB,M0689S TRIzol,ThermoFisher,15596018 Turbo

(5) APC coordinates GSK3 phosphorylation of SETD8 to suppress colorectal cancerCell ReportsMarch 24, 2026Zvi Cramer, Keara Monaghan, Ricardo Petroni, Xin Wang, Stephanie Adams-Tzivelekidis, Kayla Durning, Melissa S. Kim, Yuhua Tian, Nicolette M. Johnson, María F. Carrera Rodríguez, et al.vectors. For individual sgRNA cloning used in mESC engineering, PX459 was digested with BbsI (NEB #R3539S) and ligated with annealed sgRNAs targeting Setd8 exon 4. For individual sgRNA cloning used in cell

(6) Integrated Size-Selective Cell Purification and Electroporation for Genetic Manipulation of Primary CellsMicromachines (Basel)March 15, 2026Hyun Woo Sung, Soojung Claire Hurmanufacturer’s protocol and linearized by a single-site restriction enzyme digestion (BbsI-HF, cat# R3539S or PmeI, cat# R0560S, New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions.

(7) tRNA-based polycistronic CRISPR/Cas9 system boosts efficiency of multi-gene deletion in the moss PhyscomitrellaPlant MethodsFebruary 22, 2026Elena Kozgunovacomplementary oligonucleotides with appropriate overhangs and inserting them via BbsI-HF(New England Biolabs, #R3539S, 20,000 units/ml) digestion into a site located between a PpU6 promoter and the gRNA scaffold. The PpU6

(8) Multichannel genomic recording of biological information with ENGRAMNature ProtocolsFebruary 11, 2026Jenny F. Nathans, Troy A. McDiarmid, Wei Chen, Jay Shendureno. D4201)BsaI-HF-v2 (NEB, cat. no. R3733S)BsmBI-HF-v2 (NEB, cat. no. R0739S)BbsI-HF (NEB, cat. no. R3539S)10× rCutSmart buffer (NEB, cat. no. B6004S)10× NEBuffer™ r3.1 (NEB, cat. no. B6003S)NEBridge Ligase Master Mix

(9) Decoding the MYC locus reveals a druggable ultraconserved RNA elementbioRxivJanuary 31, 2026Peiguo Shi, Feiyue Yang, Tala Tala, Wesley Huang, Alexis O. Aparicio, Colin H. Kalicki, Aditi Trehan, Michael R. Murphy, Esther R. Rotlevi, Linqing Xing, et al.a reverse oligo (5′-AAAC–reverse complement of N20C–3′). The vector was digested with BbsI-HF (NEB, R3539S) and the correct band was purified using the Macherey-Nagel™ Gel and PCR Clean-up Kit (Macherey-Nagel,

(10) Distal enhancers regulate mammalian early embryonic lineage differentiation through long-range interactionsNucleic Acids ResearchJanuary 21, 2026Qianshu Zhu, Shimeng Guo, Juan Xie, Jiadan Qu, Xiaoyu Wan, Sicong Liang, Xiaoyu Liu, Ling Zhu, Jie Wang, Sheng Yang, et al.protein 9 for enhancer deletion The pX458 plasmid (Addgene #161 974) was digested with BbsI-HF (NEB, #R3539S) at 37°C for 4 h to generate linearized DNA templates for transient transfection. Guide RNA (gRNA)-encoding

(11) Engineered antibodies that stabilize drug-modified KRASG12C neoantigens enable selective and potent cross-HLA immunotherapyNat CommunDecember 17, 2025Lorenzo Maso, Sarah A. Mosure, Sergio A. Rodriguez-Aponte, Angelina Pizzo, Diamond N. Mensah, Matthew Southard, Samantha Sze, Tanvir Ahmed, Brian Vash, Takamitsu Hattori, et al.restriction site allowing for insertion of an sgRNA. The plasmid was linearized using BbsI-HF (NEB, R3539S). The sgRNA sequence (CATCCTGGATACTCACGACG) was designed using Alt-RTM CRISPR HDR Design Tool by IDT.

(12) Low-order assemblies drive oncogenic RTK fusion signaling without condensationbioRxivDecember 13, 2025David Gonzalez-Martinez, Thomas R. Mumford, Delaney Wilde, Sofia Wissert, Yuzhi (Carol) Gao, Emily Brackhahn, Richard Kriwacki, Elizabeth Rhoades, Lukasz J. Bugajusing NEB T4 ligase (NEB, #M0202) or NEB KLD (NEB, #M0554S); or Golden Gate cloning using BbsI (NEB, R3539S). EML4-ALK variants were cloned downstream of (C-terminal to) GFP or mCh under control of a CMV promoter.

(13) Activation of the integrated stress response contributes to developmental delay and seizures caused by mitochondrial prolyl-tRNA synthetase (PARS2) deficiencyRedox BiolDecember 9, 2025Man Xu, Yuxin Liu, Runhua Ma, Wenlu Fan, Jingwei Duan, Huan Deng, Yanbin Ma, Wanzhong GePrimeSTAR Max DNA Polymerase,TaKaRa,R045B(A × 4) T4 DNA ligase,New England Biolabs,M0202L BbsI,New England Biolabs,R3539S XbaI,New England Biolabs,R0145S BamHI-HF,New England Biolabs,R3136S T4 polynucleotide kinase,New England Biolabs

(14) miR-124 acts During Drosophila Development to Determine the Phase of Adult Circadian BehaviorJournal of Biological RhythmsDecember 1, 2025Yongliang Xia, Chenghao Chen, Patrick Emery(https://flycrispr.org/target-finder/). GAL4/UAS controlled gRNA-expressing pCFD6 vector (Addgene #73915) was digested with BbsI-HF (NEB #R3539S) and gel purified. Two inserts carrying the three gRNAs were generated by PCR reactions using pCFD6

(15) Protocol for modeling injury-induced regeneration in retinal organoids and isolating hNRSCs for subretinal transplantation in rd10 miceSTAR ProtocolsDecember 1, 2025Ming Chen, YunXi Zhang, Na Gao, WenMin Pan, Chen Cheng, Xiaoyu Liu, ShaSha Li, JianZhong Su, Hui Liu4D-Nucleofector X Kit S,Lonza,Cat# V4XP-3032 T4PNK,NEB,Cat# M0201V AgeI-HF,NEB,Cat# R3552S BbsI-HF,NEB,Cat# R3539S EcoRI-HF,NEB,Cat# R3101V SalI-HF,NEB,Cat# R3138V HindIII-HF,NEB,Cat# R3104V MfeI-HF,NEB,Cat# R3589V T4 DNA ligase

(16) Accumulation of succinate suppresses de novo purine synthesis through succinylation-mediated control of the mitochondrial folate cycleMolecular CellNovember 20, 2025Mushtaq A. Nengroo, Austin T. Klein, Heather S. Carr, Olivia Vidal-Cruchez, Umakant Sahu, Daniel J. McGrail, Nidhi Sahni, Niklas B. Thompson, Peter A. Faull, Peng Gao, et al.3-Nitropropionic Acid,Cayman,14684 Quick ligase,NEB,M2200S ethanol,Fischer,2701 Trypsin,Fisher,25-052-CI BbsI-HF,NEB,R3539S BsmBI-v2,NEB,R0739S syringe filters 0.2um,Fischer,09-720-511 Diethyl succinate,MedChemExp,HY-Y0836 Sodium

(17) Genetic Engineering of Esophageal Organoids: CRISPR-Based Knock-In for Cell Lineage TracingMethods in Molecular BiologyOctober 11, 2025Kyung-Pil Ko, Jae-Il Park10% FBS)Opti-MEM medium 2.1 Reagents for cloning Designed oligosBbsI-HF restriction enzyme (NEB, #R3539S)rCutSmart buffer (NEB)FASTAP phosphatase (Thermofisher, #EF0641)T4 Polynucleotide Kinase (PNK) (NEB,

(18) DHX36 modulates stress granule assembly independent of recruitment of mRNAs with G-quadruplex sequence motifsNucleic Acids ResearchSeptember 23, 2025Li Yi Cheng, Nina Ripin, Thomas R Cech, Roy Parker[Supplementary Table S1]) were annealed in T4 DNA ligase buffer (NEB, B0202S) and ligated into the BbsI-HF (NEB, R3539S) sites in pSpCas9(BB)-2A-GFP (PX458) (48138; Addgene) using T4 DNA ligase (NEB, B0202S). To generate

(19) PBK/TOPK mediates Ikaros, Aiolos and CTCF displacement from mitotic chromosomes and alters chromatin accessibility at selected C2H2-zinc finger protein binding sitesNature CommunicationsSeptember 23, 2025Andrew Dimond, Do Hyeon Gim, Elizabeth Ing-Simmons, Chad Whilding, Holger B. Kramer, Dounia Djeghloul, Alex Montoya, Bhavik Patel, Sherry Cheriyamkunnel, Karen E. Brown, et al.plasmid103 (a gift from Ralf Kuehn, Addgene plasmid #64324) by golden gate assembly using BbsI-HF (NEB, R3539S) and T4 DNA ligase (NEB, M0202S). A donor plasmid for Ikzf1-mNeonGreen KI was generated by incorporating

(20) A compendium of synthetic lethal gene pairs defined by extensive combinatorial pan-cancer CRISPR screeningGenome BiologySeptember 18, 2025Victoria Harle, Victoria Offord, Birkan Gökbağ, Lazaros Fotopoulos, Thomas Williams, Diana Alexander, Ishan Mehta, Nicola A. Thompson, Rebeca Olvera-León, Stefan Peidli, et al.(Monarch T1030S). We obtained a modified pDonor_mU6 vector from GeneArt and digested it with BbsI (NEB R3539S). Linearised vector was excised from an agarose gel, purified using a DNA gel extraction kit (Monarch

Be the First to Write a Review!

BbsI-HF

BbsI-HF from New England Biolabs

Description

New England Biolabs

Citations (101)

Reviews

BbsI-HF from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map