Esp3I R0734S from New England Biolabs

Product Specs
ItemEsp3I
CompanyNew England Biolabs
Price $82.00 Inquire
Catalog NumberR0734S
Size300 units
ApplicationsDNA Manipulation
TypeRestriction Enzyme
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Phage-assisted evolution of allosteric protein switchesNat CommunApril 14, 2026Nicholas T. Southern, Anna von Bachmann, Alisa Hovsepyan, Marielouise Griebl, Benedict Wolf, Nina Lemmen, Ann-Sophie Kroell, Simon Westermann, Jan Mathony, Dominik Niopekdegrade methylated template DNA. Type IIs enzymes used included Esp3I (New England Biolabs, cat. no. R0734S), BsaI-HF®v2 (R3733S), BbsI (R0539S), SapI (R0569S), and PaqCI® (R0745S). Plasmids were assembled via

(2) Glomerular basement membrane structural integrity dictates trans-tissue deposition of laminin in the kidneyCell ReportsMarch 24, 2026Kohei Omachi, Meei-Hua Lin, Pongpratch Puapatanakul, Joshua F. Begin, Karen K. McKee, Hironobu Fujiwara, Peter D. Yurchenco, Jeffrey H. MinerGoTaq Flexi DNA polymerase,Promega,M8295 KpnI,New England Biolabs,R3142S XmaI,New England Biolabs,R0180S Esp3I,New England Biolabs,R0734S NEBuilder® HiFi DNA Assembly Master Mix,New England Biolabs,E2621S T7 endonuclease,New England Biolabs,M0302L Tissue-Tek

(3) Scaling perturbations: beyond genome-scale CRISPR screensbioRxivJanuary 21, 2026Anran Tang, Rico C. Ardy, Rafaela E. Mendes, Thomas M. NormanT1030). Cloning of dual-guide libraries pRCA944 or pAT011 backbone vector was digested with Esp3I (NEB, R0734S) and Bsu36I (NEB, R0524S) and purified using 0.88X ProNex Size-Selective Beads (Promega, NG2001). The

(4) Functional Mapping of Epigenomic Regulators Uncovers Coordinated Tumor Suppression by the HBO1 and MLL1 ComplexesCancer DiscoveryDecember 2, 2025Yuning J. Tang, Haiqing Xu, Nicholas W. Hughes, Paloma Ruiz, Samuel H. Kim, Emily G. Shuldiner, Steven S. Lopez, Jess D. Hebert, Saswati Karmakar, Laura Andrejka, et al.assembly mix included 10X T4 Ligase buffer (NEB, B0202S), T4 DNA ligase (NEB, M0202S), Esp3I (NEB, R0734S), and molecular grade water (Cytiva, SH30538). The reaction was set up overnight for 70 cycles (37°C,

(5) Functional mapping of epigenomic regulators uncovers coordinated tumor suppression by the HBO1 and MLL1 complexesCancer DiscovDecember 2, 2025Yuning J. Tang, Haiqing Xu, Nicholas W. Hughes, Paloma Ruiz, Samuel H. Kim, Emily G. Shuldiner, Steven S. Lopez, Jess D. Hebert, Saswati Karmakar, Laura Andrejka, et al.assembly mix included 10X T4 Ligase buffer (NEB, B0202S), T4 DNA ligase (NEB, M0202S), Esp3I (NEB, R0734S), and molecular grade water (Cytiva, SH30538). The reaction was set up overnight for 70 cycles (37°C,

(6) Interrogating the Regulatory Function of HAQERs during Human Cortical DevelopmentbioRxivDecember 1, 2025Yashodara Abeykoon, Natalie Dzikowski, Yanting Luo, Enakshi Sinniah, Seth Weaver, Bryan J. Pavlovic, Jenelle L. Wallace, Riley J. Mangan, Craig B. Lowe, Alex A. Pollenoligo clean up kit(Zymogen, D4060). Then the oligo pool was digested using Esp3I (New England Biolabs, R0734S) for 1 hour. Low MOI sgRNA library synthesis 29 sgRNAs that were further prioritized by the high MOI

(7) Identification of epigenetic regulators of fibrotic transformation in cardiac fibroblasts through bulk and single-cell CRISPR screensNature CommunicationsNovember 26, 2025Laura Pilar Aguado-Alvaro, Nerea Garitano, Wolfgang Esser-Skala, Judy Sayers, Cynthia del Valle, Daniel Alameda, Julen Mendieta-Esteban, Maria Erendira Calleja-Cervantes, Ainhoa Goñi-Salaverri, Jon Zazpe, et al.100 ng of vector backbone, 1 μl of annealed sgRNA oligonucleotides, 1 μl Esp3I (New England Biolabs, #R0734S) and 1 μl T4 DNA Ligase (New England Biolabs, #M0202S) using the following program: 10x (5 min at 37

(8) In vivo mitochondrial base editing restores genotype and visual function in a mouse model of LHONNature CommunicationsNovember 23, 2025Sanghun Kim, Jieun Kim, Seongkwang Cha, Sungjin Ju, Chae Jin Lim, Seongho Hong, Jiyoung Bae, Yeji Oh, Sungmo Jung, Sol Pin Kim, et al.inserting TALE array, each plasmid was digested with BsaI(Cat#R3733L, New England BioLabs) and Esp3I (Cat#R0734S, New England BioLabs). Digested stuffers and TALE arrays were assembled with golden gate methods via

(9) Defining the functional role and potential as an immunotherapeutic target of ALCAM in neuroblastomaMolecular Cancer TherapeuticsNovember 7, 2025Jarrett Lindsay, Jonathan Gaither, David Groff, Minu Samanta, Rebecca Kaufman, Liron Grossmann, Nicholas Hartnett, Nathan Kendsersky, Emily A. Mycek, Sharon J. Diskin, et al.were diluted 1:10 in nuclease-free water and one-step ligation was performed using Esp3I enzyme (NEB, #R0734S) and 100 ng FgH1tUTG vector. Ligation was performed for 20 cycles at 37°C for 5 minutes, followed by

(10) Defining the Functional Role and Potential as an Immunotherapeutic Target of ALCAM in NeuroblastomaMol Cancer TherNovember 7, 2025Jarrett Lindsay, Jonathan Gaither, David Groff, Minu Samanta, Rebecca Kaufman, Liron Grossmann, Nicholas Hartnett, Nathan Kendsersky, Emily A. Mycek, Sharon J. Diskin, et al.were diluted 1:10 in nuclease-free water and one-step ligation was performed using Esp3I enzyme (NEB, #R0734S) and 100 ng FgH1tUTG vector. Ligation was performed for 20 cycles at 37°C for 5 minutes, followed by

(11) Anticodon Edited Transfer RNAs (ACE-tRNAs) Encoded as Therapeutic Nonviral Minimal DNA VectorsbioRxivSeptember 11, 2025Joseph J. Porter, Wooree Ko, Emily G. Sorensen, Zachary Cheung, Tyler Couch, Jeffrey T. Gabell, Victoria Shwe, Julia Hyatt, Jennasea B. Licata, Luke K. Peterson, et al.and miniplasmid, the resulting minicircle DNA was digested overnight at 37 °C with 10 μL Esp3I (NEB, R0734S) and 20 μL T5 exonuclease (NEB, M0663S) per 500 μg minicircle in 1x cutsmart buffer (NEB). The resulting

(12) Targeting SUMO2 reverses aberrant epigenetic rewiring driven by SS18::SSX fusion oncoproteins and impairs sarcomagenesisThe EMBO JournalAugust 13, 2025Rema Iyer, Anagha Deshpande, Aditi Pedgaonkar, Pramod Akula Bala, Taehee Kim, Gerard L Brien, Darren Finlay, Kristiina Vuori, Alice Soragni, Hiromi I Wetterstein, et al.reagents","Chemicals, enzymes and other reagents","Chemicals, enzymes and other reagents" Esp3I,NEB,R0734S Polyethylenimine,VWR,9002-98-6 polybrene,Millipore Sigma,TR-1003 puromycin,Millipore Sigma,P7255 Matrigel,Corning,356234 DNase

(13) Chemical and topological design of multicapped mRNA and capped circular RNA to augment translationNature BiotechnologyJuly 1, 2025Hongyu Chen, Dangliang Liu, Abhishek Aditham, Jianting Guo, Jiahao Huang, Franklin Kostas, Kamal Maher, Mirco J. Friedrich, Ramnik J. Xavier, Feng Zhang, et al.sequence15. Linear mRNA synthesis and characterization DNA plasmids were linearized by Esp3I (NEB, R0734S) or another type IIS restriction enzyme as specified if Esp3I was present in the CDS. Linearized plasmids

(14) Circular RMST cooperates with lineage-driving transcription factors to govern neuroendocrine transdifferentiationCancer CellMay 12, 2025Mona Teng, Jiacheng Guo, Xin Xu, Xinpei Ci, Yulin Mo, Yakup Kohen, Zuyao Ni, Sujun Chen, Wang Yuan Guo, Martin Bakht, et al.from ThermoFisher and annealed in presence of T4 PNK. Backbones were digested with Esp3I (NEB, cat. #R0734S) and gel purified with Monarch DNA gel extraction kit (NEB cat. #T1020S). sgRNA oligos and digested

(15) Branched chemically modified poly(A) tails enhance the translation capacity of mRNANature BiotechnologyFebruary 1, 2025Hongyu Chen, Dangliang Liu, Jianting Guo, Abhishek Aditham, Yiming Zhou, Jiakun Tian, Shuchen Luo, Jingyi Ren, Alvin Hsu, Jiahao Huang, et al.optimized vector. mRNA synthesis and characterization The DNA plasmids were linearized by Esp3I (NEB, R0734S). The linearized plasmids are purified with the DNA Clean and Concentrator-25 kit from Zymo Research

(16) A benchmarked, high-efficiency prime editing platform for multiplexed dropout screeningNature methodsJanuary 1, 2025Cirincione A, Simpson D, Yan W, McNulty R, Ravisankar P, Solley SC, Yan J, Lim F, Farley EK, Singh M, et al.efficiencies’ section). To complete the cloning, the intermediate library was digested with Esp3I enzyme (NEB R0734S) at 37 °C for 6 h and gel purified. The epegRNA scaffold sequence (5′-GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC)66

(17) TGF-β and RAS jointly unmask primed enhancers to drive metastasisCellOctober 31, 2024Jun Ho Lee, Francisco J. Sánchez-Rivera, Lan He, Harihar Basnet, Fei Xavier Chen, Elena Spina, Liangji Li, Carles Torner, Jason E. Chan, Dig Vijay Kumar Yarlagadda, et al.used. In brief, pUSEPB vector was linearized with BsmBI (NEB, Cat #: R0739S) or Esp3I (NEB, Cat #: R0734S) and ligated with BsmBI and Esp3I-compatible annealed and phosphorylated oligonucleotides encoding sgRNAs,

(18) MultiGreen: A multiplexing architecture for GreenGate cloningPLOS ONESeptember 18, 2024Vincent J. Pennetti, Peter R. LaFayette, Wayne Allen Parrottprocured from NEB (New England Biolabs, Ipswich, MA) including BsaI-HF-v2 (NEB #R3733S), Esp3I (NEB #R0734S), NEBuilder HiFi DNA Assembly Master Mix (NEB #E2621S), NEBridge Ligase Master Mix (NEB # M1100S), and

(19) CRISPR-Cas9 editing of synaptic genes in human embryonic stem cells for functional analysis in induced human neuronsSTAR ProtocolsJune 21, 2024Aiden Houcek, Z. Zack Ma, Brent Trauterman, Burak Uzay, Lisa M. Monteggia, Ege T. KavalaliM0302S NEBuffer 2,NEB,Cat# B7002S rCutSmart buffer,NEB,Cat# B6004S EcoRV,NEB,Cat# R0195 Esp3I,NEB,Cat# R0734S HiFi DNA assembly reaction kit,NEB,Cat# E2621 10× Klentaq1 reaction buffer,Klentaq,Cat# RB20 Klentaq

(20) Genomic context sensitizes regulatory elements to genetic disruptionMolecular CellMay 16, 2024Raquel Ordoñez, Weimin Zhang, Gwen Ellis, Yinan Zhu, Hannah J. Ashe, André M. Ribeiro-dos-Santos, Ran Brosh, Emily Huang, Megan S. Hogan, Jef D. Boeke, et al.Systems,4423 CopyControl Induction Solution,Lucigen,CCIS125 DNA endonuclease DNase I,Sigma,D4527-20KU Esp3I,NEB,R0734S FBS,BenchMark,100-106 ganciclovir,Sigma,PHR1593 geneticin G418,ThermoFisher,10131035 GlutaMAX,ThermoFisher,35050061 GoTaq

Be the First to Write a Review!

Esp3I

Esp3I from New England Biolabs

Description

New England Biolabs

Citations (33)

Reviews

Esp3I from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map