T4 Polynucleotide Kinase M0201L from New England Biolabs

Product Specs
ItemT4 Polynucleotide Kinase
CompanyNew England Biolabs
Price $228.00 Inquire
Catalog NumberM0201L
Format10 u/µl
Size2500 units
Molecule NamePolynucleotide Kinase
ActivityOne Richardson unit is defined as the amount of enzyme catalyzing the incorporation of 1 nmole of acid-insoluble [32P] in 30 minutes at 37°C.
ApplicationsDNA Manipulation
TypeEnzymes
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) A DNA-guided prokaryotic argonaute enables programmable RNA cleavage for sequencing and quality control of in vitro-transcribed RNAsMolecular Therapy Nucleic AcidsSeptember 8, 2026Lizhi Liu, Eric A. Hunt, Eric J. Wolf, Ivan R. Corrêa, Erbay Yigit, Sebastian Grünberghandler (Beckman Coulter) and phosphorylated using T4 polynucleotide kinase (New England Biolabs, #M0201S) according to the manufacturer’s protocols. For multiplexing experiments and when indicated, a 1x enhancer

(2) Assembly of exon junction complexes on spliceosomes begins before spliceosome activationNucleic Acids ResAugust 24, 2026Elizabeth T Abshire, Lynne E Maquatantisense). Each sense and antisense pair was annealed, phosphorylated at their 5′ end using T4 PNK (M0201S, New England Biolabs) and then ligated with BbsI-HF-digested (R3539S, New England Biolabs) pU6-(BbsI)-MYC-Cas9-T2A-mCherry

(3) A cofactor-promiscuous HMGR from the Lyme disease pathogen illuminates diversity in bacterial isoprenoid biosynthesisProtein SciAugust 19, 2026Isaac A. Paddy, Joshua McCausland, Madelyn Frazier, Poulami Chatterjee, Mekedlawit Setegne, Oliv Eidam, Christine Jacobs-Wagner, Laura M. K. Dassama5′‐AGTGATTAAAAAGAAAATCTTCAT‐3′ and 5′‐AACATGAAGATTTTCTTTTTAATC‐3′ were phosphorylated using T4 PNK (NEB M0201S) and ligated to SapI‐digested pBbdCas9S(RBSmut)‐Psyn‐sgRNA500 using T7 DNA ligase (NEB M0318S). The

(4) Reassessment of the roles of coronin proteins as actin effectors and in signalingPLoS BiolAugust 18, 2026Roko Gvozdenica Šipić, Haiyan Zhang, Andrii Kharin, Jerneja Koren, Viviana D'Otolo, Yuko Nariai, Takeshi Urano, Pawel Pelczar, Klemens Fröhlich, Alexander Schmidt, et al.sgRNA primers were first phosphorylated and annealed using the T4 polynucleotide kinase (NEB, CAT: M0201L). The annealed primers were and the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector (Addgene, plasmid CAT: 62988)

(5) Cross-species R-DeeP profiling reveals a conserved core of RNA-dependent proteins in yeastNucleic Acids ResAugust 13, 2026Nadine Bianca Wäber, Johanna Franziska Seidler, Fabienne Thelen, Palina Kot, Silke Schreiner, Thomas Timm, Günter Lochnit, Katja Sträßer, Cornelia KilchertTrypsin Gold, Mass spectrometry Grade (Promega, V5280), HaloTEV protease (Promega, G6601), T4 polynucleotide kinase (NEB, M0201S). Antibodies: rabbit IgG, whole molecule (ChromPure, 011-000-003), anti-TAP tag polyclonal antibody

(6) Chromatin topology and distal elements underlie divergent cell-type-specific regulation of 9p21 locus cell cycle genesCell GenomicsAugust 12, 2026Elena Torlai Triglia, Tyler E. Miller, Neva C. Durand, Kyung Lock Kim, Salvador Casaní-Galdón, Joshua D’Antonio, Nauman Javed, Alessandro Paz Hernandez, Ayush Raman, Anna J. Cruz, et al.generated from ∼1 M cell inputs were incubated in end-repair reactions (25 U T4 Polynucleotide Kinase (NEB, M0201), 50 mM NaCl, 10 mM Tris-HCl pH 7.5, 10 mM MgCl2, 100 μg/mL BSA, 2 mM ATP (NEB, P0756) and 5 mM DTT

(7) Compound delivery of eVLPs enhances prime editing for targeted genome engineering and high-throughput screeningCell GenomicsAugust 12, 2026Jethro Langley, Lou Baudrier, Jada Curry, Kiran Narta, Hayley M. Todesco, Kyle Potts, Sorana Morrissy, Douglas J. Mahoney, Pierre Billondescribed.80,81 Briefly, oligonucleotides were phosphorylated using T4 polynucleotide kinase (NEB, M0201) and annealed by heating to 95°C for 5 min followed by slow cooling to room temperature. Successful

(8) Loss of cellular RNA homeostasis contributes to MDA5 activation during virus infectionNat ImmunolAugust 11, 2026Natália G. Sampaio, Tanja Davis, Linden J. Gearing, Antonio G. Dias Junior, Lise Chauveau, Georgie Wray-McCann, Valerie Odon, Vladyslava Liudkovska, Alexandra L. McAllan, Chiara Cursi, et al.twice with PNK buffer. RNA in samples was 3’ end-dephosphorylated using T4 PNK (New England Biolabs, M0201L) for 20 min, with addition of RNase inhibitor and Turbo DNase I (Life Technologies AM2238, 2 U μl−1).

(9) Protocol for proteomic profiling of hypusinated protein candidates using a clickable spermidine probeSTAR ProtocAugust 10, 2026Tian Zhang, Jianlong Li, Xinbo Hu, Hua Zhu, Xin Zhou, Zheng-Jiang Zhu, Li Tan, Zhaoyin Wang, Yaoyang Zhang, Junying Yuan, et al.(PNK) reaction buffer,New England Biolabs,Cat#B0201S T4 Polynucleotide Kinase,New England Biolabs,Cat#M0201S 10× rCutSmart buffer/NEBuffer,New England Biolabs,Cat#B6004S T4 DNA ligase,New England Biolabs,Cat#M0202S Agarose,Bio-Rad,Cat#1613101 QIAquick

(10) Tumour-Derived Extracellular Vesicles Containing dsRNA Induce Degradation of Ribosomal Protein mRNA in PlateletsJ Extracell VesiclesAugust 10, 2026Gaoge Sun, Yuhuan Tao, Zihan Liu, Kaixiang Zhang, Shuai Zuo, Shanwen Chen, Shufang Ning, Tianyi Zhang, Pengyuan Wang, Ying Zhang, et al.buffer (without ATP), 2 µL ATP (10 mM) (NEB, P0756S), 0.5 µL T4 polynucleotide kinase (10 U/µL) (NEB, M0201S), 0.4 µL Poly(A) polymerase (5 U/µL) (NEB, M0276S), 0.5 µL RNase Inhibitor (40 U/µL). The mixture was

(11) Click-code-seq protocol for genome-wide single-nucleotide-resolution mapping of major types of DNA modificationsSTAR ProtocAugust 10, 2026Lucie Lefevre, Emilie A. Aghajani, Navnit K. Singh, Livia Maria Anna Pietrow, Nikolai J.L. Püllen, Vakil Takhaveev, Shana J. Sturla(Fpg),NEB,Cat#M0240S Endonuclease IV (EndoIV),NEB,Cat#M0304S T4 Polynucleotide Kinase (T4 PNK),NEB,Cat#M0201S Therminator IX DNA polymerase,NEB,Custom synthesis "Bst DNA Polymerase, Full Length",NEB,Cat#M0328S Taq DNA Ligase

(12) Identification and structure determination of a type III-Bv CRISPR complex that post-translationally modifies an associated toxinStructureAugust 6, 2026Shishir Pandey, Nathaniel Burman, William S. Henriques, Tanner Wiegand, Trevor Zahl, Hannah Nyquist, Tanner Spreeuw, Murat Buyukyoruk, Blake WiedenheftI),Worthington Biochemical,CAT# LS003926 T4 Polynucleotide Kinase (T4 PNK),New England Biolabs,CAT# M0201S Q5 High-Fidelity DNA Polymerase,New England Biolabs,CAT# M0491S Quick CIP (Calf Intestinal Phosphatase),New England Biolabs

(13) Nascent chain folding status modulates ribosome dynamics and mRNA stability through the ribosome-associated chaperone Zuo1Mol CellAugust 6, 2026Suhee Chang, Ryan Kawalerski, Mehmet Tardu, Sophie Martin, Kristin S. Koutmou, Jeff Collerbuffer/temperature overnight with probes end-labelled with ɣ−32P-ATP using T4 Polynucleotide Kinase (NEB M0201S) (probes listed in Table S2). Blots were washed with 6X SSC, 0.1% SDS twice at room temperature for

(14) Coordinated RNA- and protein-templated synthesis of double-stranded DNA by a dual reverse transcriptase immune systemCellAugust 6, 2026Megan Wang, Kanta Yoneyama, Rimantė Žedaveinytė, Junichiro Ishikawa, Stephen Tang, Hoang C. Le, Tanner Wiegand, Josephine L. Ramirez, Naoto Nagahata, Yanzhe Ma, et al.,Thermo Fisher Scientific,Cat#AM2238 RppH,New England Biolabs,Cat#M0356 T4 polynucleotide kinase,New England Biolabs,Cat#M0201 DNase I,New England Biolabs,Cat#M0303 Exonuclease I,New England Biolabs,Cat#M0568 MmeI,New England Biolabs

(15) An optimized CRISPR/Cas9-based genome editing platform enhances bacteriocin production in Lactiplantibacillus plantarumJ Biol EngJuly 29, 2026Rajat Anand, Rudolf Lütticken, Laura De Laporte, Andreas Herrmann, Elisabeth HeineR3150S, R3189S, R0176S, R3133S, R3104S, respectively). T4 Polynucleotide Kinase (T4 PNK NEB, Cat. no. M0201S), shrimp alkaline phosphatase (rSAP, NEB Cat. no. M0371S) were used for the phosphorylation and dephosphorylation

(16) ABL kinase inactivation induces transcription-replication conflicts and impairs replication fork progression in metastatic small cell lung cancerCell ReportsJuly 28, 2026Jing Jin Gu, Kevin M. Scott, Arijit Ghosh, Roberto H. Barbier, Douglas C. Rouse, Jacob P. Hoj, Michael W. Caminear, Fengqi Zhang, Boya Gao, Margaret W. Barbier, et al.5’-GACTCCCACGAAGAACTTGCC-3’). The linearized vector was phosphorylated using T4 Polynucleotide Kinase (NEB Cat# M0201) then ligated using T4 ligase (NEB Cat# M0202) and transformed into Stbl3 E. Coli (Thermofisher Cat#

(17) High-resolution chromatin mapping reveals that CTCF anchors meiotic loops to the chromosome axisNat CommunJuly 28, 2026Gang Cheng, Xin Li, Kevin Brick, Benjamin Alleva, Mini Huang, Kwan-Wood Gabriel Lam, Florencia Pratto, R. Daniel Camerini-Otero10xNEBbuffer2.1, 3 μl 100 mM DTT (ThermoFisher, A39255), 2 μl 100 mM ATP (ThermoFisher, R0441), 2 μl T4 PNK (NEB, #M0201L), and 30 μl H2O) and incubating at 37 °C for 5 min. Then 8 μl 5 U/μL Klenow Fragment (NEB, M0210S) was

(18) Single-nucleotide RNA m6A mapping in bovine preimplantation development reveals site-specific regulation of RPL12 at zygotic genome activationCell ReportsJuly 28, 2026Rajan Iyyappan, Yichi Niu, Yang Li, Hao Ming, Kinga Pajdzik, Noah R. Rakestraw, Piyush K. Jain, Chuan He, Chenghang Zong, Zongliang JiangNo.#10777019 EDTA,Thermo Fisher Scientific,Cat. No.#15575020 T4 Polynucleotide Kinase,New England BioLabs,Cat. No.#M0201L PEG 8000,New England BioLabs,Cat. No.#M0373L "T4 RNA Ligase 2, truncated KQ",New England BioLabs,Cat.

(19) Dose-dependent sensitivity of human three-dimensional chromatin to a heart disease–linked transcription factorScienceJuly 23, 2026Zoe L. Grant, Shuzhen Kuang, Shu Zhang, Abraham J. Horrillo, Zhe Chen, Kavitha S. Rao, Cemre Celen, Vasumathi Kameswaran, Carine Joubran, Pik Ki Lau, et al.U Klenow fragment DNA polymerase (New England Biolabs, #M0210L), 50 U T4 PNK (New England Biolabs #M0201L), 400 μM dNTP (Promega #U1511), and 1x T4 DNA ligase buffer with 10 mM ATP (New England Biolabs #B0202S)

(20) Quantitative profiling of basal and stress-induced ribosome collisionsbioRxivJuly 22, 2026James Marks, Pedro H Ayres-Galhardo, Bavavarshini Tamilselvam, Alexis Roberson, Ruby Pitts, Nicholas Guydosh, Sezen MeydanMonosome footprints, disome footprints, and size markers were first dephosphorylated with T4 PNK (NEB, M0201) for 1 hour at 37°C followed by linker ligation with truncated T4 RNA ligase 2 (NEB, M0351) to pre-adenylated

Write a Review

(1)

4/19/2016T4 Kinase Kit Benjamin GerovacThis kit is used to add 5' phosphate groups to digested DNA so it can be ligated and cloned.

In Vitro Transcription and Immobilized Template Analysis of Preinitiation Complexes
January 01, 2012
In Vitro Selection of RNA Aptamers to a Protein Target by Filter Immobilization
October 01, 2009
Serial Analysis of Gene Expression (SAGE): Experimental Method and Data Analysis
October 01, 2007
Construction of Bacterial Artificial Chromosome (BAC/PAC) Libraries
July 01, 2001

T4 Polynucleotide Kinase

T4 Polynucleotide Kinase from New England Biolabs

Description

New England Biolabs

Citations (1857)

Reviews

Protocols

In Vitro Transcription and Immobilized Template Analysis of Preinitiation Complexes

In Vitro Selection of RNA Aptamers to a Protein Target by Filter Immobilization

Serial Analysis of Gene Expression (SAGE): Experimental Method and Data Analysis

Construction of Bacterial Artificial Chromosome (BAC/PAC) Libraries

T4 Polynucleotide Kinase from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map