BceAI from New England Biolabs

Product Specs
ItemBceAI
CompanyNew England Biolabs
Price $294.00 Inquire
Catalog NumberR0623L
Quantity250 units
ApplicationsDNA Manipulation
TypeRestriction Enzyme
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) In vivo modeling of lethal congenital contracture syndrome 1 suggests pathomechanisms in cellular stress responsesThe FEBS journalDecember 1, 2025Zárybnický T, Lindfors S, Metso S, Koivula J, Szabo Z, Valtonen R, Tulppo M, Magga J, Saarimäki S, Bläuer S, et al.SimpliAmp™ Thermal Cycler (A24811; Thermo Fisher, Singapore). Enzyme digestion of the PCR product by BceAI (R0623L; NEB, Ipswich, MA, USA) had been used for the Gle1 KI mice to distinguish the carriers of the insertion.

(2) A novel phosphoglucomutase‐deficient mouse model reveals aberrant glycosylation and early embryonic lethalityJournal of Inherited Metabolic DiseaseSeptember 1, 2019Bijina Balakrishnan et al.TGCCTTACAGCACCTCAGTG Reverse: AACCCAGCACTCAGCAATCC The PCR product is digested with BceAI (New England Biolabs cat. no. R0623L) and resolved by a 2 % agarose gel. Ultrasound studies Immediately after mating began, six female

Be the First to Write a Review!

BceAI

BceAI from New England Biolabs

Description

New England Biolabs

Citations (2)

Reviews

BceAI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map