HiScribeT7 Quick High Yield RNA Synthesis Kit from New England Biolabs

Product Specs
ItemHiScribeT7 Quick High Yield RNA Synthesis Kit
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberE2050S
Quantity50 reactions
ApplicationsFunctional Genomics
Brand/TrademarkNew England Biolabs Inc (NEB)
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Rapid specific detection of oral bacteria using Cas13-based SHERLOCKJournal of Oral MicrobiologyDecember 31, 2023Jett Liu, Camden Carmichael, Hatice Hasturk, Wenyuan Shi, Batbileg Bora ssDNA template, a T7 primer (5’ - GAAATTAATACGACTCACTATAGGG − 3’), and the HiScribe T7 kit (NEB, #E2050S). Growth of target bacteria and gDNA isolation Seven target bacteria were grown in the conditions

(2) An isothermal CRISPR-based diagnostic assay for Neisseria gonorrhoeae and Chlamydia trachomatis detectionMicrobiology SpectrumDecember 12, 2023Hao Luo, Lihong Zeng, Xiaona Yin, Yuying Pan, Jianjiang Yang, Mingjing Liu, Xiaolin Qin, Zhanqin Feng, Wentao Chen, Heping Zheng37°C for 16 h using the HiScribe T7 Quick High Yield RNA Synthesis kit (New England Biolabs, MA, USA; E2050S) for crRNA transcription. RNA XP clean beads (Beckman, Brea, CA; A63987) were used to purify products

(3) Codon optimality modulates protein output by tuning translation initiationbioRxivDecember 1, 2023Elijah F Lyons, Lou C Devanneaux, Ryan Y Muller, Anna V Freitas, Zuriah A Meacham, Maria V McSharry, Van N Trinh, Anna J Rogers, Nicholas T Ingolia, Liana F LareauConcentrate column (Zymo, D4004). In vitro transcription was performed using a T7 Quick HiScribe kit (NEB, E2050S) according to manufacturer’s instructions with overnight incubation at 37°C, then treated with DNase.

(4) The structural basis of mRNA recognition and binding by yeast pseudouridine synthase PUS1PLOS ONENovember 8, 2023Sebastian Grünberg, Lindsey A. Doyle, Eric J. Wolf, Nan Dai, Ivan R. Corrêa, Erbay Yigit, Barry L. Stoddardthe duplex was in vitro transcribed using the HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB # E2050S) following the standard IVT protocol and purified using Monarch® RNA Cleanup columns (NEB # T2030). PUS1

(5) mRNA‐based Vaccines Targeting the T‐cell Epitope‐rich Domain of Epstein Barr Virus Latent Proteins Elicit Robust Anti‐Tumor Immunity in MiceAdvanced ScienceOctober 27, 2023Ge‐Xin Zhao, Guo‐Long Bu, Gang‐Feng Liu, Xiang‐Wei Kong, Cong Sun, Zi‐Qian Li, Dan‐Ling Dai, Hai‐Xia Sun, Yin‐Feng Kang, Guo‐Kai Feng, et al.3′‐UTR are listed in Table S2 (Supporting Information).[ 91 , 92 ] The HiScribe T7 RNA Kit (NEB, E2050S) was utilized to generate uncapped mRNA transcripts. The cap structure was added later with Vaccinia

(6) Precise genome editing of the Kozak sequence enables bidirectional and quantitative modulation of protein translation to anticipated levels without affecting transcriptionNucleic Acids ResearchOctober 13, 2023Jingke Xie, Zhenpeng Zhuang, Shixue Gou, Quanjun Zhang, Xia Wang, Ting Lan, Meng Lian, Nan Li, Yanhui Liang, Zhen Ouyang, et al.and then transcribed using the HiScribe™ T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, E2050S). The CBE mRNAs and sgRNAs were purified with the RNeasy MiniElute Cleanup kit (Qiagen, 74204) according

(7) Genotype-specific precision tumor therapy using mitochondrial DNA mutation-induced drug release systemScience AdvancesSeptember 29, 2023Yanan Li, Ru Xu, Yonghua Wu, Jialing Guo, Fenglei Quan, Yiran Pei, Di Huang, Xiu Zhao, Hua Gao, Junjie Liu, et al.(EP0092) were purchased from Thermo Fisher Scientific. HiScribeTM T7 Quick High Yield RNA Synthesis Kit (E2050S) was purchased from NEB (New England Biolabs, Ipswich, MA). Hoechst 33342 (C1027), Mito-Tracker Green

(8) Quantitation and integrity evaluation of RNA genome in lentiviral vectors by direct reverse transcription-droplet digital PCR (direct RT-ddPCR)Scientific ReportsSeptember 2, 2023Zhiyong He, Edward J. Kwee, Megan H. Cleveland, Kenneth D. Cole, Sheng Lin-Gibson, Hua-Jun Hein vitro synthesized by using HiScribe T7 Quick High Yield RNA Synthesis kit (New England Biolabs, Cat# E2050S). In vitro synthesized lentiviral RNA was purified with Qiagen RNeasy kit (Qiagen Cat# 74134) according

(9) An in vitro CRISPR-Cas12a-mediated protocol for direct cloning of large DNA fragmentsSTAR ProtocolsSeptember 1, 2023Xiaoqian Zeng, Shuliu Wang, Mindong Liang, Weishan Wang, Yue Jiang, Fei Xu, Leshi Liu, Hao Yan, Yaojun Tong, Lixin Zhang, et al.One Step Cloning Kit,Vazyme,Cat# C112-02 HiScribeTM T7 Quick High Yield RNA Synthesis Kit,NEB,Cat# E2050S RNA Clean & ConcentratorTM-5 kit,Zymo Research,Cat# R1013 E.Z.N.A.® Plasmid Mini Kit I,Omega,Cat#

(10) Fluorescent PCR-based Screening Methods for Precise Knock-in of Small DNA Fragments and Point Mutations in ZebrafishBio ProtocAugust 5, 2023Blake Carrington, Raman Sood(Takara, catalog number: 639125)HiScribe T7 Quick High Yield RNA Synthesis kit (NEB, catalog number: E2050S)RNA Clean and Concentrator-5 kit (Zymo Research, catalog number: R1016) Critical: Other RNA purification

(11) Screening Linear and Circular RNA Transcripts from Stress GranulesGenomics, proteomics & bioinformaticsAugust 1, 2023Chen S, Zhang J, Zhao F.transcribed from the annealed products using a HiScribe T7 Quick High Yield RNA Synthesis Kit (Catalog No. E2050S, New England Biolabs, Ipswich, MA) and biotin RNA labeling mix (Catalog No. 11685597910, Roche) according

(12) A metabolic map of the DNA damage response identifies PRDX1 in the control of nuclear ROS scavenging and aspartate availabilityMolecular Systems BiologyJuly 11, 2023Amandine Moretton, Savvas Kourtis, Antoni Gañez Zapater, Chiara Calabrò, Maria Lorena Espinar Calvo, Frédéric Fontaine, Evangelia Darai, Etna Abad Cortel, Samuel Block, Laura Pascual‐Reguant, et al.targeting PRDX1 (5′‐GCCACAGCTGTTATGCCAGA‐3′). T7 in vitro transcription was performed using HiScribe (NEB E2050S), using PCR‐generated DNA as a template. The 4D‐Nucleofector System X‐Unit (Lonza) was used for nucleofection,

(13) IVT generation of guideRNAs for Cas9-enrichment Nanopore SequencingbioRxivJuly 6, 2023Timothy Gilpatrick, Josh Zhiyong Wang, David Weiss, Alexis L Norris, James Eshleman, Winston Timp28004). GuideRNA production 75ng of the amplified library was used as input for an RNA Synthesis Kit (NEB, E2050S) and concentrated using a Monarch RNA clean-up kit (NEB, T2040S). The IVT gRNAs were either kept on

(14) Use of the dTAG system in vivo to degrade CDK2 and CDK5 in adult mice and explore potential safety liabilitiesToxicological SciencesJune 28, 2023Paul Yenerall, Tae Sung, Kiran Palyada, Jessie Qian, Seda Arat, Steven W Kumpf, Shih-Wen Wang, Kathleen Biddle, Carlos Esparza, Stephanie Chang, et al.in vitro transcription using the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, catalog no. E2050S). This product was treated with 1 µl of DNase (from the HiScribe T7 kit) and purified using the Zymo

(15) A SERS-signalled, CRISPR/Cas-powered bioassay for amplification-free and anti-interference detection of SARS-CoV-2 in foods and environmental samples using a single tube-in-tube vesselJournal of Hazardous MaterialsJune 15, 2023Long Ma, Wenlu Zhang, Lijuan Yin, Yaru Li, Jianwen Zhuang, Liang Shen, Shuli Man(Cpf1) from Lachnospiraceae bacterium ND2006 (#M0653T), HiScribeT7 Quick High Yield RNA Synthesis Kit (#E2050S) and Monarch® RNA Cleanup Kit (#T2040S) were purchased from New England Biolabs (USA). M-MLV Reverse Transcriptase

(16) A non-enzymatic test for SARS-CoV-2 RNA using DNA nanoswitchesmedRxivJune 8, 2023Javier Vilcapoma, Asmer Aliyeva, Andrew Hayden, Arun Richard Chandrasekaran, Lifeng Zhou, Jibin Abraham Abraham Punnoose, Darren Yang, Clinton Hansen, Simon Chi-Chin Shiu, Alexis Russell, et al.purified N gene PCR product as input using NEB HiScribe T7 Quick Yield RNA Synthesis Kit (NEB Cat. No. E2050S) following the manufacturer’s protocol with the following modifications: 1 μL of Sigma polyvinylsulfonic

(17) CRISPR/Cas9-Mediated Knockout of tnfaip1 in Zebrafish Plays a Role in Early DevelopmentGenes (Basel)April 28, 2023Shulan Huang, Hongning Zhang, Wen Chen, Na Su, Changyue Yuan, Jian Zhang, Shuanglin Xiang, Xiang Huwas synthesized using an in vitro transcription kit (HiScribe™T7 Quick High Yield RNA Synthesis Kit, E2050S, NEB, USA) and, subsequently, purified using an RNA purification kit (RC201, Vazyme, Nanjing, China).

(18) Epigenetic landscape reveals MECOM as an endothelial lineage regulatorNature CommunicationsApril 25, 2023Jie Lv, Shu Meng, Qilin Gu, Rongbin Zheng, Xinlei Gao, Jun-dae Kim, Min Chen, Bo Xia, Yihan Zuo, Sen Zhu, et al.guide-RNA (gRNA) was synthesized using HiScribe T7 Quick High Yield RNA Synthesis kit (NEB, Cat. No. E2050S); the target sequences for mecom were 5′- GGTGGGTGGATGGTGAGATC-3′. The gRNA (50 ng/ul) and Cas9 mRNA

(19) RPA/CRISPR-cas12a as a specific, sensitive and rapid method for diagnosing Ehrlichia canis and Anaplasma platys in dogs in ThailandVeterinary Research CommunicationsMarch 30, 2023Suphaporn Paenkaew, Nongluck Jaito, Waranee Pradit, Siriwadee Chomdej, Korakot Nganvongpanit, Puntita Siengdee, Kittisak BuddhachatThe gRNA was synthesized using in vitro transcription by HiScribe™ T7 High Yield RNA Synthesis kit (E2050S, NEB, England). The synthetic double-stranded DNA as the template to generate gRNAs was purchased from

(20) Collateral activity of the CRISPR/RfxCas13d system in human cellsCommunications biologyMarch 28, 2023Shi P, Murphy MR, Aparicio AO, Kesner JS, Fang Z, Chen Z, Trehan A, Guo Y, Wu X.In vitro transcription In vitro transcription RNA was synthesized using T7 RNA synthesis kit (New England Biolabs, E2050S). Briefly, T7 primer (GAAATTAATACGACTCACTATAGGG), DsRed gRNA with RfxCas13d pre-gRNA scaffold (CATCCACGCTGTTTTGACCTCCGTTTCAAACCCCGACCAGTTGGTAGGGGTTCGGTGTTTCCCCTATAGTGAGTCGTATTAATTTC),

Be the First to Write a Review!