Acc65I from New England Biolabs

Product Specs
ItemAcc65I
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberR0599L
Concentration10 u/µL
Quantity10000 units
ApplicationsDNA Manipulation
Brand/TrademarkNew England Biolabs Inc (NEB)
TypeRestriction Enzyme
Temperature-20 C

Sequence

G/GTACC

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) CRISPR-associated type V proteins as a tool for controlling mRNA stability in S. cerevisiae synthetic gene circuitsNucleic Acids ResearchFebruary 22, 2023Lifang Yu, Mario Andrea Marchisioterminator), into a cut-open pRSII405 backbone via Gibson method. pRSII405 was digested with Acc65I (NEB-R0599S) and SacI-HF (NEB-R3156S). TUs containing As/LbCas12a or LwaCas13a repeat along the 5′ UTR or MbCas12a

(2) Engineering a two-gene system to operate as a highly sensitive biosensor or a sharp switch upon induction with β-estradiolScientific ReportsDecember 16, 2022Tian Zhou, Zhiying Liang, Mario Andrea Marchisiointegrative backbone was cut-open (5 µg in a 30 µl solution) with the restriction endonucleases Acc65I (NEB-R0599S) and SacI (NEB-R0156S) to remove the MCS. At the end of the digestion, the two enzymes were heat-inactivated

(3) A Mutated Nme1Cas9 Is a Functional Alternative RNase to Both LwaCas13a and RfxCas13d in the Yeast S. cerevisiaeFrontiers in Bioengineering and BiotechnologyJune 2, 2022Yadan Zhang, Huanhuan Ge, Mario Andrea Marchisiopurified as above. The pRSII shuttle vector was digested with SacI-HF (NEB-R3156S) and Acc65I (NEB-R0599S) for 1 h at 37°C to generate a cut-open backbone that was then incubated for 20 min at 65°C to inactivate

(4) Unresolved stalled ribosome complexes restrict cell-cycle progression after genotoxic stressMolecular cellApril 21, 2022Stoneley M, Harvey RF, Mulroney TE, Mordue R, Jukes-Jones R, Cain K, Lilley KS, Sawarkar R, Willis AE.,New England Biolabs,Cat. #R3136 XhoI,New England Biolabs,Cat. #R0146 Acc65I,New England Biolabs,Cat. #R0599 ApaI,New England Biolabs,Cat. #R0114 XbaI,New England Biolabs,Cat. #R0145S HindIII,New England Biolabs,Cat.

(5) Analysis of Drosophila Atg8 proteins reveals multiple lipidation-independent rolesAutophagySeptember 2, 2021András Jipa, Viktor Vedelek, Zsolt Merényi, Adél Ürmösi, Szabolcs Takáts, Attila L. Kovács, Gábor V. Horváth, Rita Sinka, Gábor Juhász3ʹ-UTR region of Atg8b was amplified using GATATAGCGGCCGCGGAGGTGGCATGGATATGAACTA CCAGTACAAGAAGG and CTCGAGGTACCAGCCGATCAGTTTGCACGCTTC primers and cloned it into the above vector as a NotI (NEB, R3189)Acc65I (NEB, R0599S) fragment. To generate the C-terminal FLAG-containing Atg8b con struct lacking the glycine at position

(6) Novel S. cerevisiae Hybrid Synthetic Promoters Based on Foreign Core Promoter SequencesInternational Journal of Molecular SciencesMay 27, 2021Xiaofan Feng, Mario Andrea Marchisiothe pRSII406 vector was cut-open with Acc65I (NEB- Int. J. Mol. Sci. 2021, 22, 5704 13 of 15 R0599S) and SacI (NEB-R0156S). Touchdown PCR [51] was used to extract DNA sequences from their original plasmids.

(7) The ubiquitin ligase RFWD3 is required for translesion DNA synthesisMolecular CellFebruary 4, 2021Irene Gallina et al.,New England BioLabs,Cat#M0262S Exonuclease I,New England BioLabs,Cat#M0293S Acc65I restriction enzyme,New England BioLabs,Cat#R0599L HincII restriction enzyme,New England BioLabs,Cat#R0103S SapI restriction enzyme,New England BioLabs,Cat#R0596S "Proteinase

(8) Distinct subnetworks of the thalamic reticular nucleusNatureJuly 30, 2020Yinqing Li et al.to remove the Cre from pAAV60231, pAAV60231 was digested by Acc65I and EcoRI (New England Biolabs, #R0599 and #R3101) and the plasmid backbone was agarose gel purified. EGFP-KASH was PCR amplified from pAAV60231

(9) An intestinal zinc sensor regulates food intake and developmental growthNatureApril 1, 2020Redhai S, Pilgrim C, Gaspar P, Giesen LV, Lopes T, Riabinina O, Grenier T, Milona A, Chanana B, Swadling JB, et al.R (see below). The PCR products were cloned into pTV Cherry using NotI and Acc651 (NEB #R0189 and #R0599, respectively) or AscI and SpeI (NEB #R0558 and #R3133, respectively) restriction enzymes. The completed

(10) A Bicistronic Plasmid Encoding Brain-Derived Neurotrophic Factor and Urokinase Plasminogen Activator Stimulates Peripheral Nerve Regeneration After InjuryJournal of Pharmacology and Experimental TherapeuticsMarch 1, 2020Maxim Karagyaur, Alexandra Rostovtseva, Ekaterina Semina, Polina Klimovich, Vadim Balabanyan, Pavel Makarevich, Vladimir Popov, Dmitry Stambolsky, Vsevolod Tkachuk(New England Biolabs, #R0104S) restriction sites (Kozak, 1984). huPA cDNA (cloned using Acc65I (New England Biolabs, #R0599S) and EagI (New England Biolabs, #R0505S) restriction sites) was separated from hBDNF by HCV IRES (Lukavsky, 2009),

(11) FGF20-expressing, Wnt-Responsive Olfactory Epithelial Progenitors Regulate Growth of Underlying Turbinates to Optimize Epithelial Surface AreaDevelopmental CellSeptember 1, 2018Lu M. Yang, Sung-Ho Huh, David M. Ornitzmake antisense probe, the plasmid was linearized with restriction enzyme Acc65I (New England Biolabs, R0599S) and transcribed with T7 RNA polymerase (New England Biolabs, M0251S) according to manufacturer’s instructions,

(12) A HIF-LIMD1 negative feedback mechanism mitigates the pro-tumorigenic effects of hypoxiaEMBO molecular medicineAugust 1, 2018Foxler DE, Bridge KS, Foster JG, Grevitt P, Curry S, Shah KM, Davidson KM, Nagano A, Gadaleta E, Rhys HI, et al.annealed and ligated into psiRNA‐DUO plasmid (Invivogen # ksirna4‐gz3) with Acc65I and HindIII (NEB #R0599S and #R0104S). The knockdown‐rescue shRNA lentiviral system was a kind gift from Greg Longmore (Feng

Be the First to Write a Review!

Acc65I

Acc65I from New England Biolabs

Sequence

New England Biolabs

Citations (12)

Reviews

Acc65I from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map