KiCqStart® SYBR® Green Primers from MilliporeSigma

Product Specs
ItemKiCqStart® SYBR® Green Primers
CompanyMilliporeSigma
Price Supplier Page View Company Product Page
Catalog NumberKSPQ12012
ApplicationsPCR

Add to Compare List

MilliporeSigma

400 Summit Drive

Burlington, Massachusetts 01803

United States

Phone: (800)-645-5476
(800)-645-5439

Company Profile

Website: www.SigmaAldrich.com/

(1) Impaired Plakophilin-2 in obesity breaks cell cycle dynamics to breed adipocyte senescenceNature communicationsAugust 22, 2023Lluch A, Latorre J, Serena-Maione A, Espadas I, Caballano-Infantes E, Moreno-Navarrete JM, Oliveras-Cañellas N, Ricart W, Malagón MM, Martin-Montalvo A, et al.Biosystems) and SYBR Green I, with forward/reverse paired primers (KiCqStart® SYBR® Green Primers; Sigma, KSPQ12012), were used to assess the expression of gene candidates in a Light Cycler 480 II sequence detection

(2) Semaphorin 4B is an ADAM17-cleaved adipokine that inhibits adipocyte differentiation and thermogenesisMolecular metabolismJuly 1, 2023Amin A, Badenes M, Tüshaus J, de Carvalho É, Burbridge E, Faísca P, Trávníčková K, Barros A, Carobbio S, Domingos PM, et al.available SYBR Green I, with forward/reverse paired primers (KiCqStart® SYBR® Green Primers; Sigma, KSPQ12012), were used to assess the expression of gene candidates in a Light Cycler 480 II sequence detection

(3) Enhanced mitochondrial fission inhibits triple-negative breast cancer cell migration through an ROS-dependent mechanismiScienceJune 16, 2023Brock A. Humphries, Anne Zhang, Johanna M. Buschhaus, Avinash Bevoor, Alex Farfel, Shrila Rajendran, Alyssa C. Cutter, Gary D. Luker005557;RRID:IMSR_JAX:005557 ,, Oligonucleotides,Oligonucleotides,Oligonucleotides ,, KiCqStart® SYBR® Green Primers - PISD,Millipore Sigma,Cat# KSPQ12012; H_PISD_1 KiCqStart® SYBR® Green Primers – Drp1,Millipore Sigma,Cat# KSPQ12012; H_DNM1L_1 KiCqStart® SYBR® Green Primers

(4) Diverse effector and regulatory functions of fibro/adipogenic progenitors during skeletal muscle fibrosis in muscular dystrophyiScienceJanuary 20, 2023Xingyu Wang, Jianming Chen, Sachiko T. Homma, Yinhang Wang, Gregory R. Smith, Frederique Ruf-Zamojski, Stuart C. Sealfon, Lan ZhouOligos,N/A Mmp14 (Forward): 5′-CTTCAAAGGAGATAAGCACTG-3′,Millipore Sigma,KiCqStart® SYBR® Green Primers: Cat# KSPQ12012 Mmp14 (Reverse): 5′-AGAAGTAGGTCTTCCCATTG-3′,Millipore Sigma,KiCqStart® SYBR® Green Primers: Cat# KSPQ12012 Ltbp4

(5) Cardiomyocyte p38 MAPKÎ± suppresses a heartâ€“adipose tissueâ€“neutrophil crosstalk in heart failure developmentBasic Research in CardiologyDecember 1, 2022Katharina Bottermann, Lisa Kalfhues, Rianne Nederlof, Anne Hemmers, Lucia M. Leitner, Vici Oenarto, Jana Nemmer, Mirjam Pfeffer, Vidisha Raje, Rene Deenen, et al.Il1b, Cxcl5, Cxcr2, Slc2a4, Ppargc1a, PDK4, Angptl4, TGFb2 (KiCqStart® SYBR® Green Primers, Sigma (#KSPQ12012)), for primer sequence see Supplemental Table S2. To compare different qPCR plates a consistent calibrator

(6) Crosstalk between AML and stromal cells triggers acetate secretion through the metabolic rewiring of stromal cellseLifeSeptember 2, 2022Vilaplana-Lopera N, Cuminetti V, Almaghrabi R, Papatzikas G, Rout AK, Jeeves M, González E, Alyahyawi Y, Cunningham A, Erdem A, et al.of Hk2 (NM_013820), Pdhx (NM_175094), Pdk1 (NM_172665), and Pdk2 (NM_133667; all KiCqStart primers KSPQ12012, Sigma Aldrich) were carried out using the SYBRGreen Master mix (Thermo Fisher Scientific) and qRT-PCR

(7) A microRNA Cluster Controls Fat Cell Differentiation and Adipose Tissue Expansion By Regulating SNCGAdvanced science (Weinheim, Baden-Wurttemberg, Germany)February 1, 2022Rodríguez-Barrueco R, Latorre J, Devis-Jáuregui L, Lluch A, Bonifaci N, Llobet FJ, Olivan M, Coll-Iglesias L, Gassner K, Davis ML, et al.Biosystems) and SYBR Green I, with forward/reverse paired primers (KiCqStart SYBR Green Primers; Sigma, KSPQ12012), were used to analyze the expression of genes and miRNA candidates in a Light Cycler 480 II sequence

(8) Dual targeting of polyamine synthesis and uptake in diffuse intrinsic pontine gliomasNature CommunicationsDecember 1, 2021Aaminah Khan et al.value relative to controls. ODC1, SAT1, SLC3A2, and LIN28B KiCqStart SYBR Green predesigned primers (KSPQ12012) were purchased from Sigma Aldrich. Let-7 miRCURY LNA miRNA PCR primes were purchased from GeneGlobe

(9) Comprehensive targeting of resistance to inhibition of RTK signaling pathways by using glucocorticoidsNature CommunicationsDecember 1, 2021Ke Gong et al.COL4A4, COL5A2, COL6A3, ANGPT1-2, NGF, BDNF, NTF3, VEGFC, WNT5A) used were KiCqStart SYBR Green Primers (KSPQ12012) predesigned by Millipo-Sigma. The first design for each target was used, excepted for GDNF using the

(10) Calcium Dobesilate Modulates PKCδ-NADPH Oxidase- MAPK-NF-κB Signaling Pathway to Reduce CD14, TLR4, and MMP9 Expression during Monocyte-to-Macrophage Differentiation: Potential Therapeutic Implications for AtherosclerosisAntioxidants (Basel, Switzerland)November 11, 2021Njau F, Haller H.5′-CAGCCTTTGACCTTATGT-3′ and reverse primer 5′-CCTGTGCTGTAGTCGCA-3′) and the housekeeping gene Actin B (KSPQ12012, Sigma–Aldrich, Steinheim, Germany) was performed using SBYR Green RT-PCR (Applied Biosystems, Dreieich,

(11) CXCR6 by increasing retention of memory CD8⁺ T cells in the ovarian tumor microenvironment promotes immunosurveillance and control of ovarian cancerJournal for ImmunoTherapy of CancerOctober 4, 2021Ravikumar Muthuswamy et al.iScript cDNA synthesis kit (#170889, BIO-RAD). cDNA was quantified by using predesigned KiCqStart SYBR Green primers (#KSPQ12012, Sigma Aldrich; sequences of the primers provided in online supplemental table 1) specific for the various

(12) Dual Network Composites of Poly(vinyl alcohol)-Calcium Metaphosphate/Alginate with Osteogenic Ions for Bone Tissue Engineering in Oral and Maxillofacial SurgeryBioengineering (Basel)July 28, 2021Lilis Iskandar, Lucy DiSilvio, Jonathan Acheson, Sanjukta DebUniversal SYBR® Green (BioRad, CA, USA) and KiCqStart™ SYBR® Green predesigned human gene primers (SIGMA KSPQ12012): glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as housekeeping gene, runt-related transcription

(13) Oxygen-Mediated Suppression of CD8+ T Cell Proliferation by Macrophages: Role of Pharmacological Inhibitors of HIF DegradationFrontiers in ImmunologyMay 12, 2021Milos Gojkovic, Pedro P. Cunha, Gabriella S. Darmasaputra, Laura Barbieri, Helene Rundqvist, Pedro Veliça, Randall S. JohnsoniScript cDNA Synthesis Kit (1708890, Bio Rad) followed by realtime analysis using KiCqStart SYBR Green predesigned primers (KSPQ12012, Sigma-Aldrich) for Nos2 (GeneID: 18126) and Hprt (GeneID: 15452). The optimal dose of FG4592 was selected

(14) Cancer LncRNA Census 2 (CLC2): an enhanced resource reveals clinical features of cancer lncRNAsNAR CancerApril 14, 2021Adrienne Vancura, Andrés Lanzós, Núria Bosch-Guiteras, Mònica Torres Esteban, Alejandro H Gutierrez, Simon Haefliger, Rory Johnsonlevels of LINC00570 (FP: 5′ TAGGAGTGCTGGAGACTGAG 3′, RP: 5′ GTCGCCATCTTGGTTGTCTG 3′), ROCK2 (Sigma KSPQ12012, sequence unknown) and housekeeping genes HPRT1 (FP: 5′ ATGACCAGTCAACAGGGGACAT 3′, RP: 5′ CAACACTTCGTGGGGTCCTTTTCA

(15) RACK1 Mediates NLRP3 Inflammasome Activation by Promoting NLRP3 Active Conformation and Inflammasome AssemblyCell reportsNovember 17, 2020Duan Y, Zhang L, Angosto-Bazarra D, Pelegrín P, Núñez G, He Y.kit,QIAGEN,Cat# 74104 iScriptTM cDNA Synthesis kit,BioRad,Cat# 1708890 KiCqStart Primers,"Sigma,",Cat# KSPQ12012 Experimental Models: Cell Lines,Experimental Models: Cell Lines,Experimental Models: Cell Lines Immortalized

(16) Human bone marrow stem/stromal cell osteogenesis is regulated via mechanically activated osteocyte-derived extracellular vesiclesStem Cells Translational MedicineNovember 1, 2020Kian F. Eichholz et al.cDNA Reverse Transcription Kit (Applied Biosystems). Commercially available primers (Sigma Aldrich, KSPQ12012) were used to determine levels of cyclooxygenase 2 (COX2), osteocalcin (OCN), osteopontin (OPN), runt‐related

(17) Decreased autophagy and fuel switching occur in a senescent hepatic cell model systemAging (Albany NY)July 26, 2020Brijesh Kumar Singh, Madhulika Tripathi, Reddemma Sandireddy, Keziah Tikno, Jin Zhou, Paul Michael Yenusing QuantiTect SYBR Green PCR kit and KiCqStart SYBR Green optimized primers from Sigma-Aldrich (KSPQ12012). Protein extraction and expression analysis by Western blotting Cultured cells or 50 mg of liver

(18) Role of Citicoline in an in vitro AMD modelAging (Albany NY)May 29, 2020Sonali Nashine, M. Cristina KenneyQT00039942, Qiagen). KiCqStart® SYBR® green primers were used to examine the expression of VEGF gene (Cat. # kspq12012, Sigma). Specific housekeeper gene used was HPRT1 (Cat. # QT00059066, Qiagen). Data analysis was performed

(19) MiR-219a-5p Enriched Extracellular Vesicles Induce OPC Differentiation and EAE Improvement More Efficiently Than Liposomes and Polymeric NanoparticlesPharmaceuticsFebruary 21, 2020Iñaki Osorio-Querejeta et al.of the cells, using KiCqStart SYBR Green qPCR ReadyMix and KiCqStart SYBR Green Primers (KCQS02 and KSPQ12012, Sigma). Ribosomal protein L13α (Rpl13a) and phosphoglycerate kinase 1 (Pgk1) were used as endogenous

(20) Oxygen Tension Regulates Lysosomal Activation and Receptor Tyrosine Kinase DegradationCancersOctober 25, 2019Hong J, Wuest TR, Min Y, Lin PC.to RT-qPCR from cell lines. Relative mRNA level was measured with primers purchased against EGFR (#KSPQ12012, Sigma-Aldrich) and VEGF (#KSPQ12012, Sigma-Aldrich). 4.5. Statistics Prism (Graphpad) was used for

Be the First to Write a Review!

KiCqStart® SYBR® Green Primers from MilliporeSigma

Description

MilliporeSigma

Citations (26)

Reviews

KiCqStart® SYBR® Green Primers from MilliporeSigma

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map