Random Primer Mix from New England Biolabs

Product Specs
ItemRandom Primer Mix
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberS1330S
Quantity100 µl
ApplicationsDNA Analysis
Brand/TrademarkNew England Biolabs Inc (NEB)
Nucleic Acid TypeRandom Primers
TypePrimer
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Aedes aegypti D7 long salivary proteins modulate blood feeding and parasite infectionmBioNovember 1, 2023Ines Martin-Martin, Bianca Burini Kojin, Azadeh Aryan, Adeline E. Williams, Alvaro Molina-Cruz, Paola Carolina Valenzuela-Leon, Gaurav Shrivastava, Karina Botello, Mahnaz Minai, Zach N. Adelman, et al.using the LunaScript RT Master Mix Kit (Primer Free) (NEB, E3025L) with 6 µM Random Primer Mix (NEB, S1330S) following the manufacturer’s instructions in 20 µL total reaction volume. Plasmodium 18S ribosomal

(2) Fluoroquinolone and beta-lactam antimicrobials induce different transcriptome profiles in Salmonella enterica persister cellsScientific ReportsOctober 31, 2023S. P. Mattiello, V. C. Barth, J. Scaria, C. A. S. Ferreira, S. D. Oliveirathe first-strand cDNA using random hexamer-primed anchored-dT primer (dT23VN) (New England BioLabs, S1330S) and ProtoScript II Reverse Transcriptase (New England BioLabs, M0368L), followed by synthesis of the

(3) Efficient genetic editing of human intestinal organoids using ribonucleoprotein-based CRISPRDisease Models & MechanismsOctober 1, 2023Nefeli Skoufou-Papoutsaki, Sam Adler, Paula D'Santos, Liz Mannion, Shenay Mehmed, Richard Kemp, Amy Smith, Francesca Perrone, Komal Nayak, Alasdair Russell, et al.conversion was performed using ProtoScript II RT standard protocol (NEB, M0368) and Random Primer Mix (NEB, S1330S). qPCR was performed using TaqMan Fast Universal PCR Master Mix (Thermo Fisher Scientific, 4352042),

(4) Teosinte Pollen Drive guides maize domestication and evolution by RNAibioRxivAugust 3, 2023Benjamin Berube, Evan Ernst, Jonathan Cahn, Benjamin Roche, Cristiane de Santis Alves, Jason Lynn, Armin Scheben, Adam Siepel, Jeffrey Ross-Ibarra, Jerry Kermicle, et al.performed as follows: 10ul of RNA, 1ul 10mM dNTP, and 2ul random primer mix (New England Biolabs, cat#S1330S) were mixed and incubated for 10 minutes at 23°C then put on ice for 1 minute. The following was then

(5) RAS-independent ERK activation by constitutively active KSR3 in non-chordate metazoaNature CommunicationsJuly 5, 2023Aline Chessel, Noémie De Crozé, Maria Dolores Molina, Laura Taberner, Philippe Dru, Luc Martin, Thierry LepagecDNA synthesis was performed using a mixture of random and anchored oligo-dT20 primers from New England Biolabs (S1330S). After synthesis, 2 µL of each sample was used to perform a PCR with Gotaq® G2 Taq polymerase from

(6) In vivo secondary structural analysis of Influenza A virus genomic RNACellular and Molecular Life SciencesMay 2, 2023Barbara Mirska, Tomasz Woźniak, Dagny Lorent, Agnieszka Ruszkowska, Jake M. Peterson, Walter N. Moss, David H. Mathews, Ryszard Kierzek, Elzbieta Kierzek1 µg of IAV-infected total RNA was used for RT reaction with 1 µl of 60 µM random primer mix (NEB, S1330S). The product was purified on the G-25 column, followed by second-strand synthesis using NEBNext Ultra

(7) Transcriptomic profiling reveals sex-specific molecular signatures of adipose endothelial cells under obesogenic conditionsiScienceJanuary 20, 2023Martina Rudnicki, Alexandra Pislaru, Omid Rezvan, Eric Rullman, Aly Fawzy, Emmanuel Nwadozi, Emilie Roudier, Thomas Gustafsson, Tara L. HaasIncorporation,Cat#M0253 QIAzol Lysis Reagent,Qiagen,Cat#79306 Random Primer Mix,New England Biolabs Incorporation,Cat#S1330S "RNase Inhibitor, Murine",New England Biolabs Incorporation,Cat#M0314S Rodent Diet With 58 kcal% Fat

(8) Orthogonal control of gene expression in plants using synthetic promoters and CRISPR-based transcription factorsPlant MethodsDecember 1, 2022Shaunak Kar, Yogendra Bordiya, Nestor Rodriguez, Junghyun Kim, Elizabeth C. Gardner, Jimmy D. Gollihar, Sibum Sung, Andrew D. Ellingtonto synthesize cDNA. After DNaseI treatment to remove any DNA contamination, random primer mix (NEB #S1330S) and M-MLV Reverse transcriptase (Invitrogen #28,025–013) were used for first strand synthesis. qRT-PCR

(9) Krüppel-like factor 7 influences translation and pathways involved in ribosomal biogenesis in breast cancerBreast cancer research : BCROctober 3, 2022Lüchtenborg AM, Metzger P, Cosenza Contreras M, Oria V, Biniossek ML, Lindner F, Fröhlich K, Malyi A, Erbes T, Gensch N, et al.Total RNA Purification Kit (#PP-210L, JenaBioscience) and cDNA generated using random primer mix (#S1330S, NEB) and Maxima Reverse Transcriptase (#EP0742, ThermoFisher Scientific) according to the manufacturer’s

(10) Gammaherpesvirus-mediated repression reveals EWSR1 to be a negative regulator of B cell responsesProceedings of the National Academy of SciencesAugust 9, 2022Yiping Wang, April Feswick, Vasiliki Apostolou, Petko M. Petkov, Emily K. Moser, Scott A. TibbettsProtoScript II reverse transcriptase (New England Biolabs, M0368S) with random primer mix (New England Biolabs, S1330S). The qPCR was performed in triplicate on the Bio-Rad CFX96 Touch Real-Time PCR Detection System using

(11) Mutations that adapt SARS-CoV-2 to mink or ferret do not increase fitness in the human airwayCell reportsFebruary 8, 2022Zhou J, Peacock TP, Brown JC, Goldhill DH, Elrefaey AME, Penrice-Randal R, Cowton VM, De Lorenzo G, Furnon W, Harvey WT, et al.Ferrets,Highgate Farms,N/A ,, Oligonucleotides,Oligonucleotides,Oligonucleotides ,, random primer mix,NEB,S1330S ARTIC Primer set V3,ARTIC Network,N/A E gene forward primer: ACAGGTACGTTAATAGTTAATAGCGT,"(Zhou et

(12) Transmission from vaccinated individuals in a large SARS-CoV-2 Delta variant outbreakCellFebruary 3, 2022Katherine J. Siddle, Lydia A. Krasilnikova, Gage K. Moreno, Stephen F. Schaffner, Johanna Vostok, Nicholas A. Fitzgerald, Jacob E. Lemieux, Nikolaos Barkas, Christine Loreth, Ivan Specht, et al.SuperScript IV reverse transcriptase,Thermo Fisher Scientific,Cat #18090200 Random Primer Mix,New England BioLabs,Cat #S1330S AMPure XP,Beckman Coulter,Cat #A63881 Q5 Hot Start High-Fidelity 2X Master Mix,New England BioLabs,Cat

(13) Identification of the Cysteine Protease Legumain as a Potential Chronic Hypoxia-Specific Multiple Myeloma Target GeneCellsJanuary 15, 2022Clees AS, Stolp V, Häupl B, Fuhrmann DC, Wempe F, Seibert M, Weber S, Banning A, Tikkanen R, Williams R, et al.oligo(dT) primers (NEB, # S1327S), 2 μM random primers (New England Biolabs, Frankfurt, Germany,, # S1330S), dNTPs (New England Biolabs, #N0446S), RNAse inhibitor (Thermo Fisher Scientific, #10777019) and 200

(14) Dynamic role of LMW-hyaluronan fragments and Toll-like receptors 2,4 in progression of bleomycin induced lung parenchymal injury to fibrosisThe Egyptian Journal of BronchologyDecember 1, 2021Apoorva Pandey, Ritu Kulshrestha, Surendra Kumar Bansalchloroform, isopropanol, MMLV (M0253S, NEB), RNase (M0314, NEB), dNTPs (N0447S, NEB), random primers (S1330S, NEB), SYBR Green (S4438, Sigma), protease inhibitor (Sigma), hyaluronan quantikine ELISA (LMW-HA <

(15) Deletion of the XIST promoter from the human inactive X chromosome compromises polycomb heterochromatin maintenanceChromosomaSeptember 1, 2021Natalia Westervelt, Andrea Yoest, Sadia Sayed, Marina Von Zimmerman, Kelly Kaps, Brian P. ChadwickNo. M030L) treated RNA was used to make complementary DNA (cDNA) using random primers (NEB, Cat. No. S1330S) and M-MuLV reverse transcriptase (NEB, Cat. No. M0253L). The cDNA was used for standard or quantitative

(16) Screening of Human Gut Bacterial Culture Collection Identifies Species That Biotransform Quercetin into Metabolites with Anticancer PropertiesInternational Journal of Molecular SciencesJune 30, 2021Ranjini Sankaranarayanan, Prabhjot Kaur Sekhon, Achuthan Ambat, Julia Nelson, Davis Jose, G. Jayarama Bhat, Joy Scariastored at −80 ◦ C until further use. 4.9. Synthesis and Sequencing of cDNA Using random primers (NEB S1330S), 75 ng rRNA-depleted total RNA (see above) was reverse-transcribed according to the manufacturer’s

(17) Aging lens epithelium is susceptible to ferroptosisFree radical biology & medicineMay 1, 2021Wei Z, Hao C, Huangfu J, Srinivasagan R, Zhang X, Fan X.nm ratio >1.8 were used. RNA was reverse transcribed to cDNA with oligo(dT) random primer mix (Cat. S1330S, New England Biolabs, Ipswich, MA) and M-MuLV reverse transcriptase (Cat. M0253S, New England Biolabs).

(18) Cellular FLICE-like inhibitory protein (cFLIP) critically maintains apoptotic resistance in human lens epithelial cellsCell death & diseaseApril 9, 2021Huangfu J, Hao C, Wei Z, Wormstone IM, Yan H, Fan X.trace of DNA being reverse transcribed to complementary DNA with an oligo(dT) random primer mix (Cat. S1330S, New England Biolabs, Ipswich, MA) and M-MuLV reverse transcriptase (Cat. M0253S, New England Biolabs).

(19) Optimized design of antisense oligomers for targeted rRNA depletionNucleic Acids ResearchJanuary 11, 2021Wesley A Phelps, Anne E Carlson, Miler T Leesynthesis, a 20 μl reaction consisting of Zymo-cleaned RNA (∼50 ng), dNTP (1 μM), random primer (NEB #S1330S) (3 μM), and DTT (10 mM) was incubated at 65°C for 5 min then transferred to ice for 2 min. 1 μl of

(20) Clustering of strong replicators associated with active promoters is sufficient to establish an early‐replicating domainThe EMBO JournalNovember 2, 2020Caroline Brossas et al.Reverse transcription reactions (RT‐QPCR+) were then performed with 5 μg of RNA and random hexamers (NEB, S1330S), using the Superscript III Reverse Transcriptase (Thermo Fisher Scientific, #18080093) according to

Be the First to Write a Review!