QX200™ ddPCR™ EvaGreen Supermix from Bio-Rad

Product Specs
ItemQX200™ ddPCR™ EvaGreen Supermix
CompanyBio-Rad
Price Pricing Info Supplier Page View Company Product Page
Catalog Number1864034
Concentration2X
Quantity500 rxns
ApplicationsPCR
Sample TypecDNA, genomic DNA, plasmid DNA
TypeSupermix
Brand/TrademarkLSG DBG

Add to Compare List

Bio-Rad

Bio-Rad Laboratories, Inc. Life Science Research Group 2000 Alfred Nobel Drive

Hercules, California 94547

United States

Phone: 800-424 6723
800-879 2289

Company Profile

Website: http://discover.bio-rad.com

Website: Bio-Rad Life Science Research Product Promotions

(1) Arginine vasopressin injection rescues delayed oviposition in cyp19a1b -/- mutant female zebrafishFront Endocrinol (Lausanne)December 8, 2023Katherine Shaw, Chunyu Lu, Xiaochun Liu, Vance L. TrudeauThe reaction mixtures were prepared, each containing 11.5 µL EvaGreen ddPCR Supermix (Bio-Rad, cat# 1864034), 0.23 µL of 10 µM gene-specific forward and revere primers, 6.04 µL nuclease-free water, and 5 µL of

(2) SND1 binds SARS-CoV-2 negative-sense RNA and promotes viral RNA synthesis through NSP9CellOctober 26, 2023Nora Schmidt, Sabina Ganskih, Yuanjie Wei, Alexander Gabel, Sebastian Zielinski, Hasmik Keshishian, Caleb A. Lareau, Liv Zimmermann, Jana Makroczyova, Cadence Pearce, et al.,New England Biolabs,M0297L 4x LDS sample buffer,Thermo Fisher Scientific,B0007 QX200 ddPCR EvaGreen Supermix,BioRad,1864034 QX200 droplet generation oil for EvaGreen,BioRad,1864006 "2′-deoxythymidine-3′,5′-bisphosphate",Biosynth,NT09781 SND1

(3) BRCA1 secondary splice-site mutations drive exon-skipping and PARP inhibitor resistancemedRxivSeptember 1, 2023Ksenija Nesic, John J. Krais, Cassandra J. Vandenberg, Yifan Wang, Pooja Patel, Kathy Q. Cai, Tanya Kwan, Elizabeth Lieschke, Gwo-Yaw Ho, Holly E. Barker, et al.QX200 Droplet Digital PCR System. PCR reactions were prepared using the QX200 ddPCR EvaGreen Supermix (2X) (BioRad, Catalog #1864034) according to manufacturer’s instructions. PCR details are provided in Supplementary Information. Targeted

(4) Excess glucose or fat differentially affects metabolism and appetite-related gene expression during zebrafish embryogenesisiScienceJuly 21, 2023Bridget Konadu, Carol K. Cox, Michael R. Garrett, Yann Gibertreverse transcription supermix for qPCR,Biorad,CAT# 1708841 Qx 200 ddPCR Evagreen supermix,Biorad,CAT#1864034 ,, Deposited data,Deposited data,Deposited data ,, RNA Sequencing data,GEO,GSE213859 ,, Experimental models

(5) Alkalinity modulates a unique suite of genes to recalibrate growth and pH homeostasisFrontiers in Plant ScienceJune 30, 2023Mitylene Bailey, En-Jung Hsieh, Huei-Hsuan Tsai, Arya Ravindran, Wolfgang SchmidtFor quality check, we used the BioRad QX200 Droplet Digital PCR EvaGreen supermix system (Cat. No. #1864034; BioRad, USA) and the Agilent High Sensitivity NGS Fragment Kit (1-6000 bp) (Cat. No. DNF-474-500; Agilent,

(6) A role for N6-methyldeoxyadenosine in C. elegans mitochondrial genome regulationbioRxivMay 17, 2023Lantana K. Grub, James P. Held, Tyler J. Hansen, Samantha H. Schaffner, Marleigh R. Canter, Evi M. Malagise, Maulik R. PatelSubstrate,Bio-Rad,#1705061 Dynabeads Protein G,ThermoFisher,100041 QX200 ddPCR EvaGreen Supermix,Bio-Rad,#1864034 ,, ,, Critical commercial assays,Critical commercial assays,Critical commercial assays Qubit dsDNA

(7) Fluoxetine Protects Retinal Ischemic Damage in MicePharmaceuticsApril 29, 2023Giovanni Luca Romano, Lucia Gozzo, Oriana Maria Maurel, Serena Di Martino, Valentina Riolo, Vincenzo Micale, Filippo Drago, Claudio Bucoloforward and reverse primer, DNase free-water, and 11 µL of 2X QX200™ddPCR™ EvaGreen Supermix (cat. no. 1864034; Bio-Rad Laboratories, Inc.) were used. A measure of 20 μL of the reaction mix were obtained to generate

(8) Tissue-specific heteroplasmy segregation is accompanied by a sharp mtDNA decline in Caenorhabditis elegans somaiScienceApril 21, 2023Nikita Tsyba, Gaomin Feng, Lantana K. Grub, James P. Held, Adrianna M. Strozak, Kristopher Burkewitz, Maulik R. Patelassays,Critical commercial assays,Critical commercial assays ,, QX200™ ddPCR™ EvaGreen Supermix,Bio-Rad,Cat#1864034 DreamTaq Green DNA Polymerase (5 U/μL),Thermo Fisher Scientific,Cat#EP0713 Phase Lock Gel-Heavy Tubes,Quantabio,Cat#2302830 Zymo

(9) Characterization of the humanized FRG mouse model and development of an AAV-LK03 variant with improved liver lobular biodistributionMolecular therapy. Methods & clinical developmentMarch 9, 2023Cabanes-Creus M, Navarro RG, Liao SHY, Scott S, Carlessi R, Roca-Pinilla R, Knight M, Baltazar G, Zhu E, Jones M, et al.GG-3′. AAV titration AAV titration was performed via ddPCR (Bio-Rad) using EvaGreen Supermix (Bio-Rad; #1864034) and following the manufacturer’s instructions. To detect AAV genomes on vectors, GFP primers were used

(10) Longitudinal single-cell profiling of chemotherapy response in acute myeloid leukemiaNature CommunicationsMarch 8, 2023Matteo Maria Naldini, Gabriele Casirati, Matteo Barcella, Paola Maria Vittoria Rancoita, Andrea Cosentino, Carolina Caserta, Francesca Pavesi, Erika Zonari, Giacomo Desantis, Diego Gilioli, et al.the company’s guidelines for miRNA profiling. ddPCR was performed using EvaGreen supermix (Bio-Rad #1864034) and one of the following miRCURY LNA PCR primer sets (Qiagen): hsa-miR-126-3p (ID 204227), hsa- let-7a-5p

(11) Discovery and Validation of Circulating microRNAs as Biomarkers for Epileptogenesis after Experimental Traumatic Brain Injury–The EPITARGET CohortInternational Journal of Molecular SciencesFebruary 1, 2023Mette Heiskanen, Shalini Das Gupta, James D. Mills, Erwin A. van Vliet, Eppu Manninen, Robert Ciszek, Pedro Andrade, Noora Puhakka, Eleonora Aronica, Asla Pitkänenmaster mix for 1 reaction (reaction volume 20 µL) contained 10 µL of 2 X QX200 ddPCR EvaGreen SuperMix (#1864034, BIO-RAD, Hercules, CA, USA), 1.0 µL nuclease-free water, and 1.0 µL miRCURY LNA PCR assay (QIAGEN).

(12) Identification and Characterization of Aptamers Targeting Ovarian Cancer Biomarker Human Epididymis Protein 4 for the Application in UrineCancers (Basel)January 10, 2023Antonija Hanžek, Frédéric Ducongé, Christian Siatka, Anne-Cécile E. DucSELEX selected aptamer template (unknown concentration), 10 μL 1× QX200™ ddPCR™ EvaGreen Supermix (ref. 1864034, Bio-Rad Laboratories, Inc., Hercules, CA, USA), 0.2 µL of 10 µM stock forward primer to a final 100

(13) Long non-coding RNA Neat1 and paraspeckle components are translational regulators in hypoxiaeLifeDecember 22, 2022Godet AC, Roussel E, David F, Hantelys F, Morfoisse F, Alves J, Pujol F, Ader I, Bertrand E, Burlet-Schiltz O, et al.kit,DG32 cartridge,Bio-Rad,#1864108, Commercial assay or kit,QX200 ddPCR EvaGreen Supermix,Bio-Rad,1864034, Commercial assay or kit,High capacity cDNA Reverse transcription kit,Thermofisher,4368814, Commercial

(14) Intestinal Apc‐inactivation induces HSP25 dependencyEMBO Molecular MedicineDecember 7, 2022Sanne M van Neerven, Wouter L Smit, Milou S van Driel, Vaishali Kakkar, Nina E de Groot, Lisanne E Nijman, Clara C Elbers, Nicolas Léveillé, Jarom Heijmans, Louis Vermeulendroplet PCR using the QX200 Droplet Digital PCR System (Bio‐Rad) in combination with EvaGreen supermix (#1864034, Bio‐Rad). Primers used to detect these Apc alleles are “Apc common” FW 5′ GTTCTGTATCATGGAAAGATAGGTGGTC

(15) Proteome-wide systems genetics identifies UFMylation as a regulator of skeletal muscle functioneLifeDecember 6, 2022Jeffrey Molendijk, Ronnie Blazev, Richard J Mills, Yaan-Kit Ng, Kevin I Watt, Daryn Chau, Paul Gregorevic, Peter J Crouch, James B W Hilton, Leszek Lisowski, et al.quantified using droplet digital PCR (ddPCR [Bio-Rad, Berkeley]) using QX200 ddPCR EvaGreen Supermix (Cat# 1864034; Bio-Rad) with eGFP primers (5’ TCAAGATCCGCCACAACATC and 5’ TTCTCGTTGGGGTCTTTGCT). All cell stocks were

(16) Long read sequencing and expression studies of AHDC1 deletions in Xia-Gibbs syndrome reveal a novel genetic regulatory mechanismHuman MutationDecember 1, 2022Varuna Chander, Medhat Mahmoud, Jianhong Hu, Zain Dardas, Christopher M. Grochowski, Moez Dawood, Michael M. Khayat, He Li, Shoudong Li, Shalini Jhangiani, et al.digital PCR (ddPCR) ddPCR was performed using the QX200 ddPCR EvaGreen SuperMix (Bio-Rad; catalog no. 1864034) in a QX200 ddPCR System (Bio-Rad; catalog no. 1864001). The primers used for RT-PCR were adopted for

(17) The autocrine loop of ALK receptor and ALKAL2 ligand is an actionable target in consensus molecular subtype 1 colon cancerJournal of Experimental & Clinical Cancer ResearchDecember 1, 2022Martina Mazzeschi et al.Digital PCR (ddPCR) was performed using QX200 ddPCR EvaGreen SuperMix (Bio-Rad, Hercules, CA, USA, cat. no. 1864034) and QX200 Droplet Digital PCR System (Bio-Rad). Briefly, for each target gene a PCR mixture containing

(18) Extracellular vesicles carrying HIV-1 Nef induce long-term hyperreactivity of myeloid cellsCell reportsNovember 22, 2022Dubrovsky L, Brichacek B, Prashant NM, Pushkarsky T, Mukhamedova N, Fleetwood AJ, Xu Y, Dragoljevic D, Fitzgerald M, Horvath A, et al.Automated Droplet Generation Oil for EvaGreen,Bio-Rad,cat#1864112 ddPCR Droplet Reader Oil,Bio-Rad,cat#1863004 QX200 ddPCR EvaGreen Supermix,Bio-Rad,cat#1864034 Critical commercial assays,Critical commercial assays,Critical commercial assays Mouse TNFα ELISA

(19) Neuronal Bmal1 regulates retinal angiogenesis and neovascularization in miceCommunications BiologyAugust 6, 2022Vijay K. Jidigam, Onkar B. Sawant, Rebecca D. Fuller, Kenya Wilcots, Rupesh Singh, Richard A. Lang, Sujata RaonM), template (250 ng) and QX200™ ddPCR™ EvaGreen Supermix with 1x as final concentration (Bio-Rad: 1864034) of total volume 20 µl were used according to the manufacturer’s instructions. Droplet generation and

(20) Distinct p53 isoforms code for opposing transcriptional outcomesDevelopmental CellAugust 1, 2022Annika Wylie, Amanda E. Jones, Simanti Das, Wan-Jin Lu, John M. Abramsresuspended in 20ul nuclease free water. ChIP enrichment was quantified by ddPCR with EvaGreen (BioRad 1864034) on a QX100 droplet reader (Robin et al., 2014, Wylie et al., 2016). ChIP DNA values were displayed

Be the First to Write a Review!

Digital PCR: Helpful Tips When Using Droplet Partitioning Technology
November 07, 2016
The concept of digital PCR (dPCR) for nucleic acid detection and quantification is not new. In 1992, Sykes et al. described a method in which they measured the number of initial DNA targets in a sample rather than PCR-... read more