Guinea Pig Complement (lyophilized) with DILUENT from Rockland Immunochemicals, Inc.

Product Specs
ItemGuinea Pig Complement (lyophilized) with DILUENT
CompanyRockland Immunochemicals, Inc.
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberC200-0005
Quantity5 mL
Concentration80mg/ml
FormatLyophilized
TypeComplement
Conjugate/Tag/LabelUnconjugated
GenderMixed
SterilityNon-sterile
ApplicationsELISA
SpeciesGuinea Pig
StorageStore Guinea Pig Complement at 4° C prior to restoration. Aliquot contents and freeze at -70° C or below. Avoid cycles of freezing and thawing. Centrifuge product if not completely clear after standing at room temperature. COMPLEMENT IS A TEMPERATURE SENSITIVE PRODUCT. IMPROPER STORAGE WILL INACTIVATE COMPLEMENT ACTIVITY

Specifications/Features

Application Note: pH: normal Immunoelectrophoresis: normal Hemoglobin: normal IgG Concentration: normal

Add to Compare List

Rockland Immunochemicals, Inc.

P.O. Box 5199

Limerick, Pennsylvania 19468

United States

Phone: (484) 791-3823
Fax: (484) 369-8654

Company Profile

Website: https://www.rockland.com

(1) Maternal DNMT3A-dependent de novo methylation of the paternal genome inhibits gene expression in the early embryoNature communicationsOctober 27, 2020Richard Albert J, Au Yeung WK, Toriyama K, Kobayashi H, Hirasawa R, Brind'Amour J, Bogutz A, Sasaki H, Lorincz M.IgG (Cedarlane, catalogue #CLA3340, 1:100 dilution) and guinea pig complement (Rockland, catalogue #C200-0005, 1:50 dilution)78. Genotyping was performed by PCR using primers for Dnmt3a (CTGTGGCATCTCAGGGTGATGAGCA

(2) Rapid fluorescent focus inhibition test optimization and validation: Improved detection of neutralizing antibodies to rabies virusJournal of immunological methodsNovember 1, 2019Timiryasova TM, Luo P, Zheng L, Singer A, Zedar R, Garg S, Petit C, Moore S, Hu BT, Brown M.

(3) Cross-Neutralizing and Protective Human Antibody Specificities to Poxvirus InfectionsCellOctober 20, 2016Gilchuk I, Gilchuk P, Sapparapu G, Lampley R, Singh V, Kose N, Blum DL, Hughes LJ, Satheshkumar PS, Townsend MB, et al.H3 ortholog, protein",This paper,N/A Catalase,MP,Cat# 190311 Guinea pig complement,Rockland,Cat# C200-0005 Baby rabbit complement,Cedarlane,Cat# CL3441-S100 ,, Critical Commercial Assays,Critical Commercial

(4) A neutralization assay for respiratory syncytial virus using a quantitative PCR-based endpoint assessmentVirology journalJune 15, 2013Varada JC, Teferedegne B, Crim RL, Mdluli T, Audet S, Peden K, Beeler J, Murata H.neutralization experiments, the antibody samples were assessed in the presence of guinea pig complement (C200-0005; Rockland Immunochemicals, Inc.; Gilbertsville, PA, USA) at 5% in the final virus/antibody mixture (complement/antibody

Be the First to Write a Review!

Guinea Pig Complement (lyophilized) with DILUENT from Rockland Immunochemicals, Inc.

Description

Specifications/Features

Rockland Immunochemicals, Inc.

Citations (4)

Reviews

Guinea Pig Complement (lyophilized) with DILUENT from Rockland Immunochemicals, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map