EcoRI from New England Biolabs

Product Specs
ItemEcoRI
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberR0101S
Concentration20-100 u/µL
Quantity10000 units
ApplicationsDNA Manipulation
Brand/TrademarkNew England Biolabs Inc (NEB)
TypeRestriction Enzyme
Temperature-20 C

Sequence

G/AATTC

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Apple CRISPR-Cas9—A Recipe for Successful Targeting of AGAMOUS-like Genes in Domestic ApplePlants (Basel)October 26, 2023Seth Jacobson, Natalie Bondarchuk, Thy Anh Nguyen, Allison Canada, Logan McCord, Timothy S. Artlip, Philipp Welser, Amy L. KlockoWaltham, MA, USA). Extracted DNA was then used for an enzyme digest with EcoRI (New England BioLabs® Inc. R0101S/L, Ipswich, MA, USA) to confirm successful gene fragment cloning, as the TOPO vector has EcoRI sites

(2) A histological protocol for quantifying the birthrates of specific subtypes of olfactory sensory neurons in miceSTAR ProtocolsSeptember 1, 2023Kawsar Hossain, Madeline Smith, Stephen W. Santoro40043 Vectashield,Vector Laboratories,Cat# H1000 Dimethyl sulfoxide,Alfa Aesar,Cat# J66650 EcoRI,NEB,Cat# R0101S HindIII,NEB,Cat# R0104S BamHI,NEB,Cat# R0136S NotI,NEB,Cat# R0189S T7 RNA polymerase,NEB,Cat# M0251L Sp6 RNA polymerase

(3) CRISPR/dCAS9-mediated DNA demethylation screen identifies functional epigenetic determinants of colorectal cancerClinical EpigeneticsAugust 24, 2023Juan Ramón Tejedor, Alfonso Peñarroya, Javier Gancedo-Verdejo, Pablo Santamarina-Ojeda, Raúl F. Pérez, Sara López-Tamargo, Ana Díez-Borge, Juan J. Alba-Linares, Nerea González-del-Rey, Rocío G. Urdinguio, et al.Crispr vector (Origene, #GE100032) was linearized using BamHI and BsmBI restriction endonucleases (NEB, #R0101S and #R0552S respectively) and purified using the NucleoSpin Gel and PCR Clean-up kit (Machery-Nagel,

(4) Genome-wide CRISPR-Cas9 screen analyzed by SLIDER identifies network of repressor complexes that regulate TRIM24iScienceJuly 21, 2023Patel LR, Stratton SA, McLaughlin M, Krause P, Allton K, Rivas AL, Barbosa D, Hart T, Barton MC.EDTA,Gibco,25300-054 FBS,Gibco,A31605 DMSO,Sigma,D8418 T4 PNK,NEB,M0201S CutSmart Buffer,NEB,B7204 Esp3I,Thermo,ER0452 EcoRI,NEB,R0101S BamHI,NEB,R0136S T4 Ligase,NEB,M0202S XbaI,NEB,R0145S HindIII,NEB,R0104S Q5 Site Direct Mutagenesis

(5) ERα-associated translocations underlie oncogene amplifications in breast cancerNatureJune 29, 2023Jake June-Koo Lee, Youngsook Lucy Jung, Taek-Chin Cheong, Jose Espejo Valle-Inclan, Chong Chu, Doga C. Gulhan, Viktor Ljungström, Hu Jin, Vinayak V. Viswanadham, Emma V. Watson, et al.were digested with XbaI (New England Biolabs, R0145L) for SHANK2 locus and EcoRI (New England Biolabs, R0101L) for RARA locus, respectively. In the first round of PCR, DNA was amplified using an adaptor-specific

(6) LINC01116 affects patient survival differently and is dissimilarly expressed in ER+ and ER− breast cancer samplesCancer Rep (Hoboken)June 15, 2023Mohammadjavad Karimi Taheri, Sogol Ghanbari, Akram Gholipour, Taraneh Givi, Majid SadeghizadehUSA(Cat No. CD511B‐1)) at sites EcoRI and NotI restriction enzymes (New England Biolabs, USA (Cat No. R0101S (EcoRI) and R0189S (NotI))). The primers used for cloning are shown as LINC01116 forward primer: 5’‐AAACCGGAATTCAGGAAATGACCCGAACTGC‐3′

(7) The Inability to Disassemble Rad51 Nucleoprotein Filaments Leads to Aberrant Mitosis and Cell DeathBiomedicinesMay 15, 2023Tadas Andriuskevicius, Anton Dubenko, Svetlana Makovetssamples collected during the time-course experiments was digested with EcoRI (NEB, Ipswich, MA, USA, R0101L) and SalI (NEB, Ipswich, MA, USA, R0138L) restriction enzymes, resolved on 0.6% TBE agarose gels (3.7

(8) Transcription-Coupled Repair of DNA Interstrand Crosslinks by UVSSAbioRxivMay 13, 2023Rowyn Church Liebau, Crystal Waters, Arooba Ahmed, Rajesh K Soni, Jean Gautieracquired from NEB: BbsI (R0539S), BamHI (R0136S), NheI-(HF R3131S), BglII (R0144S), AscI (R0558S), EcoRI (R0101S)Kits: Q5 mutagenesis kit NEB (E0554S)Equipment: Attune NXT flow cytometer (Thermo fisher scientific

(9) TAR Syndrome-associated Rbm8a deficiency causes hematopoietic defects and attenuates Wnt/PCP signalingbioRxivMay 5, 2023Agnese Kocere, Elena Chiavacci, Kevin Manuel Méndez-Acevedo, Charlotte Soneson, Max S. Hiltabidle, Azhwar Raghunath, Jacalyn S. MacGowan, Jordan A. Shavit, Daniela Panáková, Margot L. K. Williams, et al.probes were used: kdrl (using pBS-kdrl (a kind gift from Dr. Leonard I. Zon), linearized with EcoRI (R0101S, NEB), T7 polymerase for IVT) (Thompson et al., 1998); sox7 (using primer fwd 5’-CGACCAAAACTCCCTTCCG-3’

(10) Nuclear growth and import can be uncoupledbioRxivApril 25, 2023Pan Chen, Sampada Mishra, Daniel L. Levydigesting nuclear DNA, 2.5 U/µL Benzonase (Sigma, E1014), 40 U/µL MNase (NEB, M0247S), 0.2 U/μL EcoRI (NEB, R0101S), 0.2 U/μL XhoI (NEB, R0101S), or 0.5 U/μL HaeIII (NEB, R0108S) was added to X. laevis egg extract after

(11) Initial ciliary assembly in Chlamydomonas requires Arp2/3 complex–dependent endocytosisMolecular Biology of the CellApril 1, 2023Brae M. Bigge, Nicholas E. Rosenthal, Prachee AvasthiThe resulting fragment and the pChlamy4 plasmid (Thermofisher; A24231) were digested with EcoRI (NEB; R0101S) and XhoI (NEB; R0146S) for 1 h followed by heat inactivation. Then, the fragment and vector were mixed

(12) Nonstructural protein 1 widespread RNA decay phenotype varies among coronavirusesiScienceJanuary 20, 2023Bermudez Y, Miles J, Muller M.recombinant proteins","Chemicals, peptides, and recombinant proteins" ,, EcoRI,New England Biolabs,R0101S NotI-HF,New England Biolabs,R3189S Zeocin,Invitrogen,R25001 TRIzol Reagent,ThermoFisher,15596026 Turbo

(13) Easy efficient HDR-based targeted knock-in in Saccharomyces cerevisiae genome using CRISPR-Cas9 systemBioengineeredJanuary 5, 2023Rajveer Singh, Shivani Chandel, Arijit Ghosh, Anupam Gautam, Daniel H. Huson, V. Ravichandiran, Dipanjan GhoshLB broth (BD-240230), pML107 (Addgene plasmid # 67639), BclI (NEB-R0160S), SwaI (NEB-R0604S), EcoRI (NEB-R0101S), Ampicillin (SRL-69-52-3), QIAprep Spin Miniprep Kit (Qiagen-27,104), QIAquick PCR purification kit

(14) EspH interacts with the host active Bcr related (ABR) protein to suppress RhoGTPasesGut MicrobesDecember 31, 2022Rachana Pattani Ramachandran, Ipsita Nandi, Nir Haritan, Efrat Zlotkin-Rivkin, Yael Keren, Tsafi Danieli, Mario Lebendiker, Naomi Melamed-Book, William Breuer, Dana Reichmann, et al.ABR shRNA into the linearized pLKO.1 puro vector, digestion with AgeI (NEB #R3552) and EcoRI (NEB #R0101S), and ligation of oligonucleotides 27 F’ and 28 R’ into the digested plasmid were performed as described

(15) Insights into the secondary and tertiary structure of the Bovine Viral Diarrhea Virus Internal Ribosome Entry SiteRNA BiologyDecember 31, 2022Devadatta Gosavi, Iwona Wower, Irene K. Beckmann, Ivo L. Hofacker, Jacek Wower, Michael T. Wolfinger, Joanna Sztuba-SolinskaEcoRI restriction site, while the 3′ end pair added an EcoRV site. Double digestion with EcoRI (NEB, R0101S) and EcoRV (NEB, R0195S) was used for the initial screening of clones. All putative correct clones were

(16) MeCP2-induced heterochromatin organization is driven by oligomerization-based liquid–liquid phase separation and restricted by DNA methylationNucleusDecember 31, 2022Hui Zhang et al.(pc1208) [70] using a primer pair containing NdeI (NEB, R0111S) for the forward primer and EcoRI (NEB, R0101S) for the reverse primer (Table S2). Then, the GFP-MeCP2 amplified coding sequence was digested with

(17) Cloning BRD4 long isoform into overexpression vectors for stable overexpression of BRD4-L in mammalian cellsSTAR ProtocolsDecember 16, 2022Ana Luiza Drumond-Bock, Magdalena Cybula, Luyao Wang, Lin Wang, Magdalena Bieniaszspectrophotometer.41.Screen clones performing enzymatic digestion with the restriction enzymes EcoRI (NEB, cat# R0101S) and MluI (NEB, cat# R0198S):a.Using a thermocycler, digest 500 ng of LentiV_Blast-BRD4-L with EcoRI

(18) Critical roles for ‘housekeeping’ nucleases in type III CRISPR-Cas immunityeLifeDecember 8, 2022Lucy Chou-Zheng, Asma Hatoum-AslanSystem,Fisher Scientific,Cat# AM7778, "Peptide, recombinant protein",EcoRI,New England Biolabs,Cat# R0101S, "Peptide, recombinant protein",T4 Polynucleotide kinase,New England Biolabs,Cat# M0201L, "Peptide,

(19) Million spot binding array platform for exploring and optimizing multiple simultaneous detection eventsSTAR ProtocolsDecember 1, 2022Michael Gibbons, Jessica M. Hong, Mikelle Foster, Mariya Chavarha, Shirley Shao, Llyke Ching, Victoria A. Church, Lauren Schiff, Sara Ahadi, Marc Berndl, et al.(C-terminus)-3′ATCCCTTCTCTTCCTGTATACTAATAGGTGCACGTAGATTC/5Phos/,"Hong et al., 2022", EcoRI,NEB,Cat#R0101S Cutsmart buffer,NEB,Cat#B6004 Hybridization buffer (0.025% TWEEN20 in no 1× PBS),This paper, Blocking

(20) Prdm14 promotes mouse ESC self-renewal and PGCLC specification through enhancement of Stat3 activityiScienceNovember 18, 2022Li Y, Yang Z, Li X, Yu Y, Li X, Chen P, Li B, Wang X, Ye SD.JAK Inhibitor I,Santa Cruz,Cat# sc-204021 LIF,Millipore,Cat# LIF1010 AgeI,NEB,Cat# R0552S EcoRI,NEB,Cat# R0101S PCR polymerase,"Vazyme, China",Cat# P502-d1 T4 DNA Ligase,"Monad, China",Cat# MC00102M Puromycin,"YEASEN,

Be the First to Write a Review!

EcoRI

EcoRI from New England Biolabs

Sequence

New England Biolabs

Citations (142)

Reviews

EcoRI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map