Reverse Transcription System from Promega

Product Specs
ItemReverse Transcription System
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberA3500
Quantity100 reactions
PrimersOligo(dT)₁₅ Primer and Random Primers

Add to Compare List

Promega

2800 Woods Hollow Rd.

Madison, Wisconsin

United States

Phone: 800-356-9526
Fax: 800-356-1970

Company Profile

Website: http://www.promega.com

(1) HDAC1-3 inhibition increases SARS-CoV-2 replication and productive infection in lung mesothelial and epithelial cellsFront Cell Infect MicrobiolDecember 13, 2023Flavia Trionfetti, Tonino Alonzi, Giulio Bontempi, Michela Terri, Cecilia Battistelli, Claudia Montaldo, Federica Repele, Dante Rotili, Sergio Valente, Clemens Zwergel, et al.to the manufacturer’s instructions. cDNA synthesis was generated using a reverse transcription kit (A3500) from Promega (Madison, WI), according to the manufacturer’s recommendations. cDNAs were amplified by

(2) Evaluating the Effect of Gestational Exposure to Perfluorohexane Sulfonate on Placental Development in Mice Combining Alternative Splicing and Gene Expression AnalysesEnvironmental Health PerspectivesNovember 23, 2023Yihao Zhang, Jia Lv, Yi-Jun Fan, Lin Tao, Jingjing Xu, Weitian Tang, Nan Sun, Ling-Li Zhao, De-Xiang Xu, Yichao Huanginstructions. Then, reverse transcription of RNA was performed using a Reverse Transcription system (A3500; Promega, USA) to obtain cDNA by Biometra T-Gradient (Biometra biomedizinische Analytik GmbH, Germany).

(3) Focal ischemic stroke modifies microglia-derived exosomal miRNAs: potential role of mir-212-5p in neuronal protection and functional recoveryBiological researchOctober 3, 2023Li SS, Wu JJ, Xing XX, Li YL, Ma J, Duan YJ, Zhang JP, Shan CL, Hua XY, Zheng MX, et al.(Invitrogen, Carlsbad, CA, USA) and were reversely transcribed to cDNA using reverse transcription kit (A3500, Promega, Madison, WI, USA). Target genes were examined using a SYBR-Green RT–PCR kit (QPK-212, TOYOBO,

(4) Identification of new biomarkers and immune infiltration characteristics of sepsis in very low birth weight infantsBiomolecules and BiomedicineOctober 1, 2023Yujia Luo, Zhou Jiang, Rei Gu, Xuandong Zhang, Li Wei, Yuanyuan Zhou, Songying Zhangused to extract total RNA from HUVECs, which was then reverse transcribed to cDNA using an RT-PCR Kit (A3500, Promega, USA). For the real-time PCR, cDNA was combined with SYBR Green Master Mix (DBI-2044, Germany).

(5) Total Flavonoids of Rhizoma Drynariae Treat Osteoarthritis by Inhibiting Arachidonic Acid Metabolites Through AMPK/NFκB PathwayJournal of Inflammation ResearchSeptember 20, 2023Guang-Yao Chen, Xiao-Yu Liu, Xue-Er Yan, XinBo Yu, Yi Liu, Jing Luo, Qing-Wen TaoKit (H552-1, Nanjing Jiancheng Bioengineering Institute, China), cDNA Reverse Transcription System (A3500, Promega, USA), SYBR Green Realtime PCR Master Mix (QPK-201, Toyobo, Japan), Mitochondrial Membrane

(6) Elabela inhibits TRAF1/NF-κB induced oxidative DNA damage to promote diabetic foot ulcer wound healingiScienceSeptember 15, 2023Yinghui Hong, Jun Li, Yinsheng Zhong, Shujun Yang, Liying Pei, Zijie Huang, Xuxiang Chen, Hao Wu, Guanghui Zheng, Chaotao Zeng, et al.and real-time quantitative PCR The recommended protocol for the Promega Reverse Transcription Kit (#A3500, Promega, USA) was adopted. A total of 20 μl reaction system was prepared as guidance. The cDNA was

(7) BATF relieves hepatic steatosis by inhibiting PD1 and promoting energy metabolismeLifeSeptember 15, 2023Zhiwang Zhang, Qichao Liao, Tingli Pan, Lin Yu, Zupeng Luo, Songtao Su, Shi Liu, Menglong Hou, Yixing Li, Turtushikh Damba, et al.(Life Technologies, USA). Reverse transcription of RNA was performed with the Reverse Transcription System (A3500, Promega), and formed cDNA from 1 μg total RNA. 2×RealStar Green Fast Mixture was used for real-time

(8) Effects of Gestational Arsenic Exposures on Placental and Fetal Development in Mice: The Role of Cyr61 m6AEnvironmental Health PerspectivesSeptember 8, 2023Ya-Ping Song, Jin-Wei Lv, Zhi-Cheng Zhang, Qing-Hua Qian, Yi-Jun Fan, Dao-Zhen Chen, Heng Zhang, Fei-Xiang Xu, Cheng Zhang, Yichao Huang, et al.treated with DNase without RNase and reverse-transcribed with Promega reverse transcription system (#A3500; Promega). Real-time RT-PCR was performed with a LightCycler 480 SYBR Green qPCR Master Mix (#04887352001;

(9) Cognitive Alterations in Old Mice Are Associated with Intestinal Barrier Dysfunction and Induced Toll-like Receptor 2 and 4 Signaling in Different Brain RegionsCellsAugust 27, 2023Annette Brandt, Franziska Kromm, Angélica Hernández-Arriaga, Inés Martínez Sánchez, Haktan Övül Bozkir, Raphaela Staltner, Anja Baumann, Amélia Camarinha-Silva, Rochellys Diaz Heijtz, Ina Bergheimmonths old) showing too low RNA concentration were transcript to cDNA (reverse transcription system #A3500 obtained from Promega GmbH, USA) following the instructions of the manufacturer. The amplification of

(10) Comparative Analysis and Identification of Terpene Synthase Genes in Convallaria keiskei Leaf, Flower and Root Using RNA-Sequencing ProfilingPlants (Basel)July 28, 2023Sivagami-Jean Claude, Gurusamy Raman, Seon-Joo Parkand primer structure (Supplementary Table S1). For cDNA synthesis, a reverse transcription system (A3500, Promega (product made in USA), Yuseong-gu, Daejeon, Korea) was used, and 20 µL of the final cDNA product

(11) Bioinformatic Analysis and Machine Learning Methods in Neonatal Sepsis: Identification of Biomarkers and Immune InfiltrationBiomedicinesJune 28, 2023Zhou Jiang, Yujia Luo, Li Wei, Rui Gu, Xuandong Zhang, Yuanyuan Zhou, Songying Zhang(Qiagen 74034, Hilden, Germany), and this RNA was then reverse-transcribed into cDNA using an RT-PCR Kit (A3500, Promega, Madison, WI, USA). SYBR Green Master Mix (DBI-2044, Freiberg, Germany) was mixed with cDNA

(12) A LY6E-PHB1-TRIM21 assembly degrades CD14 protein to mitigate LPS-induced inflammatory responseiScienceJune 16, 2023Xinyu Zhu, Linxia Zhang, Daobin Feng, Lang Jiang, Peng Sun, Chen Zhao, Xiaoyan Zhang, Jianqing XuReverse transcription of RNA into cDNA was performed using Reverse Transcription System (Promega # A3500). The resultant cDNAs were then subjected to quantitative PCR analyses conducted on a 7300 real-time PCR

(13) IP3R-dependent mitochondrial dysfunction mediates C5b-9-induced ferroptosis in trichloroethylene-caused immune kidney injuryFrontiers in ImmunologyJune 13, 2023Zhibing Liu, Jinru Ma, Xulei Zuo, Xuesong Zhang, Haibo Xie, Feng Wang, Changhao Wu, Jiaxiang Zhang, Qixing ZhuRNA was reverse-transcribed to cDNA using the reverse transcription system (Promega Corporation, Cat. A3500) following the instruction manual. Real-time PCR was carried out using LightCycler® 480 SYBR® Green I Master

(14) Moderate intrinsic phenotypic alterations in C9orf72 ALS/FTD iPSC-microglia despite the presence of C9orf72 pathological featuresFrontiers in Cellular NeuroscienceJune 6, 2023Ileana Lorenzini, Eric Alsop, Jennifer Levy, Lauren M. Gittings, Deepti Lall, Benjamin E. Rabichow, Stephen Moore, Ryan Pevey, Lynette M. Bustos, Camelia Burciu, et al.was reverse transcribed to cDNA with oligo(dT) with the Promega Reverse Transcriptase System (Cat # A3500) and analyzed using SYBR Green Master Mix (Applied Biosystems). C9orf72 (Forward- 5′- CAGTGATGTCGACTCTTTG−3′

(15) A novel role of TRIM28 B box domain in L1 retrotransposition and ORF2p-mediated cDNA synthesisNucleic Acids ResearchMay 22, 2023Qianhui Du, Emily C Stow, Dawn LaCoste, Benjamin Freeman, Melody Baddoo, Afzaal M Shareef, Kyle M Miller, Victoria P BelancioAAGATTTTCGCCACCTACAGCAGCGACAAG LEAP reverse primer: AGTGGCACCTTCCAGGGTCAAGGAA Regular RT-PCR Reverse Transcriptase System (Promega: A3500) was used according to manufacturer's instructions. Reactions were set up at 9 ul sample. Each sample

(16) Integrated transcriptomic analysis identifies coordinated responses to nitrogen and phosphate deficiency in riceFrontiers in Plant ScienceMay 8, 2023Fei Wang, Yan Wang, Luying Ying, Hong Lu, Yijian Liu, Yu Liu, Jiming Xu, Yunrong Wu, Xiaorong Mo, Zhongchang Wu, et al.(Invitrogen). First-strand cDNA was synthesized from 1 µg of total RNA using a reverse transcription system (A3500; Promega). qPCR was performed using SYBR Green I Master (Roche) on a LightCycler 480 Real-Time PCR system

(17) DMRT1-mediated regulation of TOX3 modulates expansion of the gonadal steroidogenic cell lineage in the chicken embryoDevelopment (Cambridge, England)March 1, 2023Estermann MA, Major AT, Smith CA.(Invitrogen) and 500 ng-1µg of RNA was converted into cDNA using Promega Reverse Transcription System (A3500). RT-qPCR was performed using QuantiNova SYBR Green PCR Kit. Primers used were: TOX3 Fw, TCAGAGCTTGGATCTCCCCT;

(18) Impact of retrotransposon protein L1 ORF1p expression on oncogenic pathways in hepatocellular carcinoma: the role of cytoplasmic PIN1 upregulationBritish journal of cancerMarch 1, 2023Zadran B, Sudhindar PD, Wainwright D, Bury Y, Luli S, Howarth R, McCain MV, Watson R, Huet H, Palinkas F, et al.Fisher Scientific). Complementary DNA was generated using the cDNA Reverse Transcription Kit (Promega, A3500) as per the manufacturer’s instructions. The qRT-PCR was carried out as described previously [36]. Primers

(19) HOXB9 Overexpression Confers Chemoresistance to Ovarian Cancer Cells by Inducing ERCC-1, MRP-2, and XIAPInternational Journal of Molecular SciencesJanuary 8, 2023Dong Hoon Suh, Wook Ha Park, Miseon Kim, Kidong Kim, Jae Hong No, Yong Beom Kimmanufacturer’s instructions. cDNA was synthesized from 2 µg of RNA using a reverse transcription kit (Cat# A3500, Promega, Madison, WI, USA), and the PCR was performed using 2× PCR Master mix Solution (Cat# 25027,

(20) Role of follistatin-like 1 levels and functions in calcific aortic stenosisFrontiers in Cardiovascular MedicineJanuary 6, 2023Qianru Zhang, Jiawen Ye, Gan Yang, Ling Yang, Zhongli Chen, Ke Yang, Jia Teng Sun, Yan LiuThermo Fisher Scientific (USA) were used for immunofluorescence staining. The Reverse Transcription System (Cat# A3500, Promega, USA) and SYBR® Premix Ex Taq™ II (Tli RNaseH Plus, Cat# RR820A, Takara Bio, Japan) were used

Be the First to Write a Review!