Phusion Hot Start Flex 2X Master Mix M0536L from New England Biolabs

Product Specs
ItemPhusion Hot Start Flex 2X Master Mix
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberM0536L
Quantity500 reactions
ApplicationsDNA Analysis
Brand/TrademarkNew England Biolabs Inc (NEB)
TypeMaster Mix
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Single-cell epigenomics and spatiotemporal transcriptomics reveal human cerebellar developmentNature CommunicationsNovember 22, 2023Suijuan Zhong, Mengdi Wang, Luwei Huang, Youqiao Chen, Yuxin Ge, Jiyao Zhang, Yingchao Shi, Hao Dong, Xin Zhou, Bosong Wang, et al.pools (Twist Bioscience). We amplified the custom designed oligonucleotide pools by limited-cycle PCR (M0536L, NEB; 31000-T, Biotium). The amplified dsDNA was performed as templates for in vitro transcription started

(2) Unraveling Intestinal Microbial Shifts in ESRD and Kidney Transplantation: Implications for Disease-Related DysbiosisMicroorganismsNovember 10, 2023Pengpeng Yan, Sulin Luo, Luying Guo, Xingxia Wang, Xue Ren, Junhao Lv, Ying Chen, Xinyu Lin, Jianghua Chen, Rending Wangof 25 μL of the reaction mixture, which contained 12.5 μL of Phusion Hot Start Flex 2X Master Mix (#M0536L, NEB, Ipswich, MA, USA), 25 ng of template DNA, 2.5 μL of each primer, and appropriate PCR-grade water,

(3) Endometrial microbiota in women with and without adenomyosis: A pilot studyFrontiers in MicrobiologyJanuary 20, 2023Qi Lin, Hua Duan, Sha Wang, Zhengchen Guo, Sirui Wang, Yanan Chang, Chao Chen, Minghong Shen, Hejun Shou, Chang ZhouPolymerase chain reaction (PCR) was carried out with Phusion Hot Start Flex 2X Master Mix (New England Biolabs, M0536L). The cycling conditions for PCR were as follows: 98°C for 30 s, followed by 30 cycles of 98°C for 10

(4) The Effect of Breast Milk Microbiota on the Composition of Infant Gut Microbiota: A Cohort StudyNutrientsDecember 19, 2022Yapeng Li, Lei Ren, Yunyi Wang, Jinxing Li, Qingqing Zhou, Chenrui Peng, Yuchen Li, Ruyue Cheng, Fang He, Xi ShenPCR was conducted using 50 ng of template DNA, 12.5-μL of Phusion® Hot Start Flex 2X Master Mix (NEB, M0536L), 2.5 μL of each of the forward and reverse primers, after which the system volume was adjusted to 25

(5) Maternal gestational Bifidobacterium bifidum TMC3115 treatment shapes construction of offspring gut microbiota and development of immune system and induces immune tolerance to food allergenFrontiers in Cellular and Infection MicrobiologyNovember 14, 2022Ruyue Cheng, Yujie Zhang, Yang Yang, Lei Ren, Jinxing Li, Yimei Wang, Xi Shen, Fang Heof reaction mixture containing 50 ng of DNA, 12.5 μL of Phusion Hot start flex 2X Master Mix (NEB, M0536L), 2.5 μL of each of forward primer 338F 5’-ACTCCTACGGGAGGCAGCAG-3’ and reverse primer 806R 5’-GGACTACHVGGGTWTCTAAT-3’

(6) Characterizing single extracellular vesicles by droplet barcode sequencing for protein analysisJ Extracell VesiclesNovember 3, 2022Mahsan Banijamali, Pontus HÃ¶jer, Abel Nagy, Petra HÃ¥Ã¥g, Elizabeth Paz Gomero, Christiane Stiller, Vitaliy O. Kaminskyy, Simon Ekman, Rolf Lewensohn, Amelie Eriksson KarlstrÃ¶m, et al.reaction was performed using a master mix containing Phusion Hot Start Flex (New England BioLabs; Cat. No. M0536L) and 0.2 μM of i5‐H1 and i7‐H4’ indexing primers (see Table S2 for sequences) using the following program:

(7) Protocol for correlation analysis of the murine gut microbiome and meta-metabolome using 16S rDNA sequencing and UPLC-MSSTAR ProtocolsSeptember 1, 2022Xiaoqing Li, Peng Wu, Xiangjun Zeng, Qiulei Lang, Yu Lin, He Huang, Pengxu QianBiotec,Cat.130-0950139 E.Z.N.A.® Stool DNA Kit (200 preps),Omega,Cat#D4015-02 Phusion® Hot Start Flex 2× Master Mix,NEB,Cat#M0536L AMPure XP beads,Beckman Coulter,Cat#A63881 PhiX Control Kit v3,Illumina,Cat#FC-110-3001 NovaSeq 6000

(8) Genomic context sensitivity of insulator functionGenome ResearchMarch 1, 2022André M. Ribeiro-dos-Santos, Megan S. Hogan, Raven D. Luther, Ran Brosh, Matthew T. Mauranoreactions were prepared, each containing 500 ng PstI-digested DNA, 1× Phusion Hot Start Flex Mastermix (NEB M0536L), and 200 nM of the primer P5_Plasmid_8N/9N/10N, and incubated for 5 min at 98°C, for 1 min at 60°C,

(9) Defining genome-wide CRISPR–Cas genome-editing nuclease activity with GUIDE-seqNature ProtocolsDecember 1, 2021Nikolay L. Malinin et al.qPCR film (Bio-Rad cat. no. MSB1001) Phusion Hot Start Flex 2X Mix (New England Biolabs cat. no. M0536L) MiSeq reagent kit v3 600 cycles (Illumina cat. no. MS102-3003) Phix control V3 kit (Illumina cat.

(10) Adaptor Template Oligo-Mediated Sequencing (ATOM-Seq) is a new ultra-sensitive UMI-based NGS library preparation technology for use with cfDNA and cfRNAScientific ReportsDecember 1, 2021Thomas L. Dunwell et al.primer (5′-GTGACTGGAGTTCAGACGTGTGCTCTTCCG*A-3′) and 24 µl of Phusion Hot Start Flex 2X Master Mix (NEB, M0536L) were combined and cycled as follows, 98 °C for 30 s followed by 10 cycles of 98 °C for 5 s, 60 °C for

(11) Multiplexed single-cell profiling of chromatin states at genomic loci by expansion microscopyNucleic acids researchAugust 20, 2021Woodworth MA, Ng KKH, Halpern AR, Pease NA, Nguyen PHB, Kueh HY, Vaughan JC.(Sigma-Aldrich, A2404-1KU), catalase (Sigma-Aldrich, C100), Phusion Hot-start master mix (New England Biolabs, M0536L), DNase I (New England Biolabs, M0303A) and Maxima H Minus RT Transcriptase (Thermo Fisher Scientific,

(12) Characteristics of mouse intestinal microbiota during acute liver injury and repair following 50% partial hepatectomyExperimental and Therapeutic MedicineJuly 5, 2021Yi Shao, Yuancong Jiang, Hui Li, Feng Zhang, Zhenhua Hu, Shusen Zhengincluding 25 ng of purified DNA, 12.5 µl PCR Premix (Phusion Hot start flex 2X Master Mix; cat. no. M0536L; New England Biolabs, Inc.), 2.5 µl of each primer and PCR-grade water to adjust the volume. The PCR

(13) Efficient generation of isogenic primary human myeloid cells using CRISPR-Cas9 ribonucleoproteinsCell reportsMay 11, 2021Hiatt J, Cavero DA, McGregor MJ, Zheng W, Budzik JM, Roth TL, Haas KM, Wu D, Rathore U, Meyer-Franke A, et al.Primer3. PCR amplification was performed using Phusion 2X Master Mix HotStart Flex (New England Biolabs M0536L), 10μM primer pair (see Key resources table, Oligonucleotides), and approximately 100ng template DNA.

(14) Multiplexed Competition in a Synthetic Squid Light Organ Microbiome Using Barcode-Tagged Gene DeletionsmSystemsDecember 22, 2020Hector L. Burgos, Emanuel F. Burgos, Andrew J. Steinberger, Garret Suen, Mark J. Mandelwas obtained by PCR with Phusion Hot Start Flex 2× master mix (New England BioLabs [NEB]; catalog no. M0536L) and pHB1 as the template, which contains the LL-FRT-erm-FRT-spacer sequences and was built as described

(15) Mammalian gene expression variability is explained by underlying cell stateMolecular Systems BiologyFebruary 11, 2020Robert Foreman, Roy WollmanpEntry_GCaMP5G was linearized with PCR using standard Phusion® Hot Start Flex 2X Master Mix (NEB Cat# M0536L) protocol (FOR: cgcgccgacccag, REV: ctcgagggatccggatcctcccttcgctgtcatcatttgtacaaac). PCR product was

(16) Bamboo lignocellulose degradation by gut symbiotic microbiota of the bamboo snout beetle Cyrtotrachelus buquetiBiotechnology for BiofuelsDecember 1, 2019Chaobing Luo, Yuanqiu Li, Ying Chen, Chun Fu, Wencong Long, Ximeng Xiao, Hong Liao, Yaojun YangμL of the following reaction mixture: 50-ng DNA, 12.5-μL Phusion Hot start flex 2X Master Mix (NEB, M0536L), 2.5-μL forward primer 338F 5′-ACTCCTACGGGAGGCAGCAG-3′ and 2.5-μL reverse primer 806R 5′-GGACTACHVGGGTWTCTAAT-3′

(17) Defining CRISPR–Cas9 genome-wide nuclease activities with CIRCLE-seqNature ProtocolsApril 25, 2019Cicera R. Lazzarotto, Nhu T. Nguyen, Xing Tang, Jose Malagon-Lopez, Jimmy A. Guo, Martin J. Aryee, J. Keith Joung, Shengdar Q. TsaiA63881) CIRCLE-seq library preparation and NGS Phusion Hot Start Flex 2× Master Mix (New England BioLabs, cat.no. M0536L) HTP Library Preparation Kit PCR-free (96rxn) (Kapa Biosystems, cat.no. KK8235) PEG/NaCl SPRI solution,

(18) SiC-Seq: Single-cell genome sequencing at ultra high-throughput with microfluidic droplet barcodingNature BiotechnologyJuly 1, 2017Freeman Lan, Benjamin Demaree, Noorsher Ahmed, Adam R Abateare added to a PCR reaction mix containing 1X NEB Phusion Hot Start Flex Master Mix (NEB, catalog no. M0536L), 2% (w/v) Tween 20 (Sigma-Aldrich, catalog no. P9416), 5% (w/v) PEG-6000 (Santa Cruz Biotechnology,

(19) NLRP2 controls age-associated maternal fertilityThe Journal of experimental medicineDecember 12, 2016Kuchmiy AA, D'Hont J, Hochepied T, Lamkanfi M.5′-AAAAATGAAATGAGGAAGAGGAGG-3′; Nlrp2F2: 5′-AGTGAAAGCTGGTGTGGTGG-3′. Phusion Hot Start Flex 2X Master Mix (M0536L; NEB) was used for PCR amplification. qRT-PCR qRT-PCR was performed on a mouse normal tissue qPCR

(20) Droplet barcoding for massively parallel single-molecule deep sequencingNature CommunicationsSeptember 1, 2016Freeman Lan, John R. Haliburton, Aaron Yuan, Adam R. Abateconcentration into a PCR reaction mix containing 1 × NEB Hotstart Phusion polymerase (NEB, catalogue no. M0536L), 2% w/v Tween 20, 2% w/v PEG 6000, 400 nM forward and reverse primers (FL128 CTGTCTCTTATACACATCTCCGAGCCCACGAGACGTGTCGGGGCTGGCTTA)

Be the First to Write a Review!

Phusion Hot Start Flex 2X Master Mix

Phusion Hot Start Flex 2X Master Mix from New England Biolabs

New England Biolabs

Citations (22)

Reviews

Phusion Hot Start Flex 2X Master Mix from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map