BamHI from New England Biolabs

Product Specs
ItemBamHI
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberR0136T
Quantity10000 units
Concentration100,000 units/ml
ApplicationsDNA Manipulation
Brand/TrademarkNew England Biolabs Inc (NEB)
TypeRestriction Enzyme
Temperature-20 C

Sequence

5'-G/GATCC-3'

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Fortuitous somatic mutations during antibody evolution endow broad neutralization against SARS-CoV-2 Omicron variantsCell ReportsMay 30, 2023Jianbo Wu, Zhenguo Chen, Yidan Gao, Zegen Wang, Jiarong Wang, Bing-Yu Chiang, Yunjiao Zhou, Yuru Han, Wuqiang Zhan, Minxiang Xie, et al.,New England BioLabs,Cat#R3552L BsiwI-HF,New England BioLabs,Cat#R3553L BamH1,New England BioLabs,Cat# R0136M XhoI,New England BioLabs,Cat#R0146L SalI-HF,New England BioLabs,Cat#R3138S 10× NEB buffer 2,New England BioLabs

(2) Functional analysis of the short splicing variant encoded by CHI3L1/YKL-40 in glioblastomaFront OncolNovember 2, 2022Mengqi Shi, Qianyun Ge, Xinrong Wang, Wenbin Diao, Ben Yang, Sipeng Sun, Guohui Wang, Tian Liu, Andrew Man-Lok Chan, Zhiqin Gao, et al.purified by a gel extraction kit (Geneaid, DF300). Purified DNA fragments were digested with BamHI (NEB, #R0136T) and EcoRI (NEB, #R0101T) and cloned into the pBABE-puro and pBABE-Neo (Addgene, #1767) vectors using

(3) Probing DNA-protein interactions using single-molecule diffusivity contrastBiophysical ReportsSeptember 8, 2021Hugh Wilson, Miles Lee, Quan WangRestriction enzymes (BamHI and EcoRI) were purchased from New England BioLabs (Ipswich, MA) (BamHI: R0136M, EcoRI: R0101M) and used without further purification. The stock concentrations of the enzymes (BamHI:

(4) Systematic dissection of σ70 sequence diversity and function in bacteriaCell ReportsAugust 24, 2021Jimin Park, Harris H. WangCoulter, A63881). Purified library and pNJ7 plasmid (Johns et al., 2018) were digested with BamHI (NEB, R0136M) and PstI (NEB, R0140M), PCR purified (Zymo, D4033), and ligated with T4 DNA ligase (NEB, M0202M). Resulting

(5) An optimized protocol for the generation of HBV viral antigen-specific T lymphocytes from pluripotent stem cellsSTAR protocolsMarch 19, 2021Haque M, Xiong X, Lei F, Das JK, Song J.TCR genes,Dr. Dario A.A. Vignali (University of Pittsburgh),N/A BamH1/EcoR1,New England Biolabs,CAT# R0136T/R0101T EcoRI/BglII,New England Biolabs,CAT# R0101T/R0144M ,, "Buffer, media, and reagents","Buffer,

(6) Fluorescent Protein Variants Generated by Reassembly between Skeleton and ChromophoreACS OmegaFebruary 2, 2021Tingting Sun, Tianpeng Li, Ke Yi, Guoquan Yan, Xiaolian Gaosequences were inserted into the pET28(+) plasmid through sequential Xho I (R0146V, NEB) and BamH I (R0136T, NEB) digestion, followed by ligation with T4 ligase (M0202L, NEB). Then, the product was expressed

(7) Cyclic Peptide Mimotopes for the Detection of Serum Anti-ATIC Autoantibody Biomarker in Hepato-Cellular CarcinomaInternational journal of molecular sciencesDecember 19, 2020Heo CK, Hwang HM, Lim WH, Lee HJ, Yoo JS, Lim KJ, Cho EW.

(8) Regulation of Mother-to-Offspring Transmission of mtDNA HeteroplasmyCell metabolismDecember 3, 2019Latorre-Pellicer A, Lechuga-Vieco AV, Johnston IG, Hämäläinen RH, Pellico J, Justo-Méndez R, Fernández-Toro JM, Clavería C, Guaras A, Sierra R, et al.Recombinant Proteins" ,, Φ29 DNA polymerase,New England Biolabs,M0269L BamH1,New England Biolabs,R0136M SspI,New England Biolabs,R0132S Lambda Exonuclease.,New England Biolabs,M0262S T4 DNA ligase,New England Biolabs

(9) Structural Basis of the Differential Binding of Engineered Knottins to Integrins αVβ3 and α5β1StructureSeptember 1, 2019Johannes F. Van Agthoven et al.2009b)",N/A Peptide 2.5D,"(Kimura et al., 2009b)",N/A KpnI,New England Biolabs,R0142M BamhI,New England Biolabs,R0136M EcoRI,New England Biolabs,R0101M BssHII,New England Biolabs,R0199M XbaI,New England Biolabs,R0145M Penicillin-Streptomycin,ThermoFisher,15140122 PBS,Boston

(10) Three New Integration Vectors and Fluorescent Proteins for Use in the Opportunistic Human Pathogen Streptococcus pneumoniaeGenes (Basel)May 22, 2019Lance E. Keller, Anne-StÃ©phanie Rueff, Jun Kurushima, Jan-Willem Veening

(11) Discovery and functional characterisation of a luqin-type neuropeptide signalling system in a deuterostomeScientific ReportsDecember 1, 2018Luis Alfonso Yañez-Guerra, Jérôme Delroisse, Antón Barreiro-Iglesias, Susan E. Slade, James H. Scrivens, Maurice R. Elphickcontaining the ArLQ precursor cDNA was linearised using the restriction enzymes BamH1 (NEB; Cat. No. R0136T) for the antisense probe and Xho1 (NEB; Cat. No. R0146S) for the sense probe. The linearised plasmids

(12) SYK kinase mediates brown fat differentiation and activationNature communicationsDecember 13, 2017Knoll M, Winther S, Natarajan A, Yang H, Jiang M, Thiru P, Shahsafaei A, Chavarria TE, Lamming DW, Sun L, et al.in Supplementary Table 2. Southern blotting 10 µg genomic BAT DNA were digested with 200 U BamHI (#R0136M, NEB) for 16 h at 37 °C and separated with a 0.7% agarose gel for 24 h at 80 V at 4 °C. Following acid-base

(13) Double mimicry evades tRNA synthetase editing by toxic vegetable-sourced non-proteinogenic amino acidNature CommunicationsDecember 1, 2017Youngzee Song et al.

(14) Mettl3-mediated m6A regulates spermatogonial differentiation and meiosis initiationCell ResearchSeptember 1, 2017Kai Xu et al.Thus, purified cDNA was circularized with Circligase II (Epicentre, CL9021K) and re-linearized with BamHI (NEB, R0136M). Libraries were PCR amplified with Accuprime Supermix 1 enzyme for 18 cycles and size-selected on an

(15) Ciliary transcription factors and miRNAs precisely regulate Cp110 levels required for ciliary adhesions and ciliogenesiseLifeSeptember 13, 2016Walentek P, Quigley IK, Sun DI, Sajjan UK, Kintner C, Harland RM.Walentek et al., 2013). Subcloning was performed using BamH1 and EcoR1 (New England Biolabs, #R0101T; #R0136T) restriction enzymes and the following primers (shown 5' to 3'): Cp110 forward AAAAAAGGATCC ATGGAGCCATATGAAGAATTTTATAAG; Cp110

(16) PICH promotes sister chromatid disjunction and co-operates with topoisomerase II in mitosisNature CommunicationsDecember 8, 2015Christian F. Nielsen et al.

(17) Modulation of RNA Polymerase II Phosphorylation Downstream of Pathogen Perception Orchestrates Plant ImmunityCell Host & MicrobeDecember 10, 2014Fangjun Li et al.

(18) A genome-wide inducible phenotypic screen identifies antisense RNA constructs silencing Escherichia coli essential genesFEMS Microbiology LettersApril 1, 2012Jia Meng, Gregory Kanzaki, Diane Meas, Christopher K. Lam, Heather Crummer, Justina Tain, H. Howard Xu

(19) Tracing the Domestication of a Biofilm-Forming BacteriumJournal of BacteriologyApril 15, 2011Anna L McLoon, Sarah B Guttenplan, Daniel B Kearns, Roberto Kolter, Richard Losick

(20) Disruption of genomic neighbourhood at the imprinted IGF2-H19 locus in Beckwith-Wiedemann syndrome and Silver-Russell syndromeHuman molecular geneticsApril 1, 2011Raffaella Nativio, Angela Sparago, Yoko Ito, Rosanna Weksberg, Andrea Riccio, Adele Murrellby centrifugation at 3500 rpm for 5 min. 1.5 × 106 nuclei were resuspended in 300 μl of 1X Buffer 3 [R0136M, New England Biolabs (NEB) with added protease inhibitors (P8340, Sigma) and 1.8% Triton X-100 (T8787,

Be the First to Write a Review!

BamHI

BamHI from New England Biolabs

Description

Sequence

New England Biolabs

Citations (22)

Reviews

BamHI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map