Anti-GPR54 antibody GTX37417 from GeneTex

Description

GeneTex's Anti-GPR54 antibody is a Rabbit Polyclonal antibody. The Anti-GPR54 antibody was generated using KISS1 receptor, AXOR12, CPPB1, GPR54, HH8, HOT7T175, KISS-1R as the antigen. The Anti-GPR54 antibody from GeneTex is a Rabbit Polyclonal antibody to GPR54. The Anti-GPR54 antibody Recognizes Mouse, Rat. The Anti-GPR54 antibody has been validated for the following Applications: WB, IHC-P, IHC

Product Specs
ItemAnti-GPR54 antibody
CompanyGeneTex
Price Pricing Info Supplier Page
Catalog NumberGTX37417
ApplicationsWB, IHC-P, IHC
ReactivityMouse, Rat
ClonalityPolyclonal
TargetGPR54
IsotypeIgG
HostRabbit
Quantity100 µg
Conjugate/TagUnconjugated
Antibody TypePrimary Antibodies
NCBI Gene AliasesHOT7T175, HH8, CPPB1, AXOR12, KISS1 receptor, AXOR12, CPPB1, GPR54, HH8, HOT7T175, KISS-1R, GPR54, KISS-1R
NCBI Full Gene NameKISS1 receptor
Concentration0.5mg/ml
ImmunogenKLH conjugated synthetic peptide derived between 131-190 amino acids of human Kiss1 Receptor
PurityProtein A purified
Format0.01M TBS, 0.5% BSA, 25% Glycerol, 0.015% ProClin 300
Research AreaNeuroscience
Gene NameKISS1R
Molecular Weight43

Add to Compare List

GeneTex

GeneTex, Inc. 2456 Alton Parkway

Irvine, California 92606

United States

Phone: 1-877-GeneTex (436-3839) or 949-553-1900
Fax: 949-309-2888

Company Profile

Website: http://www.genetex.com

(1) Kisspeptin regulates the development of caprine primordial follicles in vitroJournal of Animal Reproduction and BiotechnologyMarch 31, 2021Manjula Priyantha Sumith Magamage, Sriravali Sathagopam, Kiran Avula, Di Neththi Nimesh Madushanka, Sathya Velmuruganprimer TCCCTCCCTTCTTTCCTTCCTAA Rabbit polyclonal anti-GPR54 antibody (GeneTex; Cat Reverse primer AGGGACGAGCCTGAACCGA No. GTX37417) was used for probing. HRP-conjugated Capra hircus GPR54 goat anti-rabbit IgG antibody was used as

(2) Expression of Kisspeptin and its receptor in the hypothalamus of cyclic and acyclic buffalo (Bubalus bubalis)TheriogenologyNovember 1, 2019Mishra GK, Patra MK, Singh LK, Sheikh PA, Upmanyu V, Chakravarti S, Karikalan M, Sonwane A, Singh SK, Das GK, et al.

(3) Kiss1 and its receptor: molecular characterization and immunolocalization in the hypothalamus and corpus luteum of the buffaloAnimal biotechnologyOctober 1, 2019Mishra GK, Patra MK, Singh LK, Upmanyu V, Chakravarti S, M K, Singh SK, Das GK, Kumar H, Krisnaswami N.

Be the First to Write a Review!

Anti-GPR54 antibody

Anti-GPR54 antibody

Anti-GPR54 antibody from GeneTex

Description

GeneTex

Citations (3)

Reviews

Anti-GPR54 antibody from GeneTex

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map