Fig 1: miRNA-370-3p Downregulates the Expression of MGMT and MGMTmRNA and Increases Sensitivity to TMZ In Cellulo(A and B) qRT-PCR (A) and ELISA (B) indicate that miRNA-370-3p decreases MGMT expression at the mRNA and protein levels, respectively. Mimetic wild-type (gccugcugggguggaaccuggu) or mutated (gAAugcAAggguggaaAAuggu) miR-370-3p were transfected using HiPerFect transfection reagent (QIAGEN, France) according to the manufacturer’s instructions. (C) Response of the LN18 cell line to treatment with TMZ for 72 hr was assessed by cytotoxicity assay (Abcam, ab197010, France). (D) The impact of dose-escalation miRNA-370 on TMZ (50 μM)-induced cell death was estimated by cytotoxicity assay (Abcam, ab197010, France). (E) The impact of TMZ (50 μM)-induced miR-370-3p-mediated cell death was estimated by cytotoxicity assay (Abcam, ab197010, France) on a panel of five distinct primary-cultured tumor cells (PCTC). Mimetic wild-type or mutated miR-370-3p (25 nM) were transfected using HiPerFect transfection reagent (QIAGEN, France) according to the manufacturer’s instructions. A t test (GraphPad software) compares the mean ± SD of indicated values. Histograms represent average ± SD of 3 independent experiments of the considered parameters.
Supplier Page from Abcam for MTS Assay Kit (Cell Proliferation) (Colorimetric)