PI-SceI from New England Biolabs

Product Specs
ItemPI-SceI
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberR0696S
Quantity250 units
Concentration1,000 units/ml
ApplicationsDNA Manipulation
Brand/TrademarkNew England Biolabs Inc (NEB)
TypeRestriction Enzyme
Temperature-20 C

Sequence

ATCTATGTCGGGTGC/GGAGAAAGAGGTAATGAAATGGCA

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Genome-wide identification of notochord enhancers comprising the regulatory landscape of the brachyury locus in mouseDevelopmentNovember 15, 2023Dennis Schifferl, Manuela Scholze-Wittler, Alba Villaronga Luque, Milena Pustet, Lars Wittler, Jesse V. Veenvliet, Frederic Koch, Bernhard G. Herrmannrandom integration of BACs, 5 µg of each construct were linearized using PI-SceI (New England Biolabs, R0696S) and electroporated into 3×106 mESCs. Approximately 30 h after electroporation, selection was initiated,

(2) Chimpanzee adenovirus-mediated multiple gene therapy for age-related macular degenerationiScienceOctober 20, 2023Selena Wei-Zhang, Bohao Cui, Man Xing, Jiaojiao Liu, Yingying Guo, Kai He, Tinghui Bai, Xue Dong, Yi Lei, Wei Zhou, et al.and recombinant proteins" ,, SrfI,New England Biolabs,Cat#R0629S PI-SceI,New England Biolabs,Cat#R0696S I-CeuI,New England Biolabs,Cat#R0699S PacI,New England Biolabs,Cat#R0547L ApaI,New England Biolabs,Cat#R0114S MfeI-HF,New England Biolabs

(3) A 37 kb region upstream of brachyury comprising a notochord enhancer is essential for notochord and tail developmentDevelopmentDecember 1, 2021Dennis Schifferl, Manuela Scholze-Wittler, Lars Wittler, Jesse V. Veenvliet, Frederic Koch, Bernhard G. Herrmannintegration of the Noto::H2B-mCherry BAC, 5 µg of BAC DNA were linearized using PI-SceI (New England Biolabs R0696S) and electroporated into 3×106 wild-type mESCs. Approximately 30 h after electroporation, selection

(4) Efficient and Reproducible Multigene Expression after Single-Step Transfection Using Improved BAC Transgenesis and Engineering ToolkitACS Synthetic BiologyMay 15, 2020Binhui Zhao, Pankaj Chaturvedi, David L. Zimmerman, Andrew S. Belmont(New England Biolabs, Cat. # R3189S) and all other BACs with the PI-SceI (New England Biolabs, Cat. # R0696S). Lipofectamine 2000 (Thermo Fisher Scientific, Cat. # 11668019) was used to transfect the cells with

(5) Anti-Depressant Fluoxetine Reveals its Therapeutic Effect Via AstrocytesEBioMedicineJune 1, 2018Kinoshita M, Hirayama Y, Fujishita K, Shibata K, Shinozaki Y, Shigetomi E, Takeda A, Le HPN, Hayashi H, Hiasa M, et al.cassette containing tTS and SV40 polyadenylation signal. BAC DNA was linearized by PI-SceI (Cat. # R0696S, New England Biolabs Inc., Massachusetts, U.S.A) enzyme digestion, and injected into fertilized eggs

(6) An efficient method of directly cloning chimpanzee adenovirus as a vaccine vectorNature ProtocolsNovember 1, 2010Dongming Zhou, Xiangyang Zhou, Ang Bian, Hua Li, Heng Chen, Juliana C Small, Yan Li, Wynetta Giles-Davis, Zhiquan Xiang, Hildegund C J Ertlno. R0604S) I-CeuI (New England Biolabs, cat. no. R0699S) PI-SceI (New England Biolabs, cat. no. R0696S) SgfI (Promega, cat. no. R5104) Eco47III (Promega, cat. no. R6731) Phusion hot start high-fidelity

(7) Rapid bacterial artificial chromosome modification for large-scale mouse transgenesisNature ProtocolsOctober 2, 2010Shiaoching Gong, Laura Kus, Nathaniel Heintzendonuclease (New England Biolabs, cat. no. R0180L) PI-SceI endonuclease (New England Biolabs, cat. no. R0696S) λ-DNA-HindIII Digest (New England Biolabs, cat. no. N3012S) Low-range PFG marker DNA ladder (New England Biolabs

Be the First to Write a Review!

PI-SceI

PI-SceI from New England Biolabs

Description

Sequence

New England Biolabs

Citations (7)

Reviews

PI-SceI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map