Gel Loading Dye, Purple (6X) from New England Biolabs

Product Specs
ItemGel Loading Dye, Purple (6X)
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberB7024S
Quantity4 ml
ApplicationsDNA Manipulation
Brand/TrademarkNew England Biolabs Inc (NEB)
Temperature25 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Protocol to induce de novo lipid droplets in Saccharomyces cerevisiaeSTAR ProtocolsDecember 1, 2023Amit Khatri, Vineet Choudhary(FOA),Thermo Scientific,Cat# R0811 Agarose,Lonza,Cat# 50004 Purple loading dye,New England Biolabs,Cat# B7024S "BODIPY (493/503) (4,4-difluoro-1,3,5,7,8-pentamethyl-4-bora-3a,4a-diaza-s-indacene)",Invitrogen,Cat#

(2) Rfoot‐seq: Transcriptomic RNase Footprinting for Mapping Stable RNA‐Protein Complexes and Rapid Ribosome ProfilingCurrent ProtocolsNovember 20, 2023Qianru Li, Emily K. Stroup, Zhe Jimolecular biology grade, (Promega, cat. no. V4251) 6x Gel loading dye (New England BioLabs, cat. no. B7024S) DsDNA markers for library size selection (see Reagents and Solutions) 100 bp DNA ladder (New England BioLabs

(3) Efficient Large DNA Fragment Knock-in by Long dsDNA with 3′-Overhangs Mediated CRISPR Knock-in (LOCK) in Mammalian CellsBIO-PROTOCOLOctober 20, 2023Wenjie Han, Haojun Liang, Jianqiang Bao(Sangon Biotech, catalog number: B548101)6× Gel Loading Dye Purple (New England Biolabs, catalog number: B7024S)SDS-PAGE Protein Loading Buffer, 5× (Beyotime, catalog number: P0286)BeyoColor Prestained Color Protein

(4) Glycosylation Circuit Enables Improved Catalytic Properties for Recombinant Alkaline PhosphataseACS OmegaOctober 3, 2023Eray Ulaş Bozkurt, İrem Niran Çağıl, Ebru Şahin Kehribar, Musa Efe Işılak, Urartu Özgür Şafak Şekerand5′CCAGTGCAATAGTGCTTTGTTTCATGTTTCTCCTCTTTAATACTAGTTTAAATTTTAAGTTTAAAAACCTTAG3′. PCR products were mixed with 6× purple loading dye (New England Biolabs Inc. Boston, USA, B7024S) and run in 1% agarose gel. 1kb+ Ladder (New England Biolabs Inc. Boston, USA, N3200L) was utilized

(5) Programmable site-specific DNA double-strand breaks via PNA-assisted prokaryotic ArgonautesNucleic Acids ResearchSeptember 22, 2023Tin Marsic, Sivakrishna Rao Gundra, Qiaochu Wang, Rashid Aman, Ahmed Mahas, Magdy M Mahfouzfollowed by incubation at 37°C for 30 min. Four microliters of 6× Gel Loading Dye Purple (NEB; catalog # B7024S) was added to each sample, which was then loaded onto a 0.9% (w/v) agarose gel with GelRed® and electrophoresed

(6) HDR-based CRISPR/Cas9-mediated Knockout of PD-L1 in C57BL/6 MiceBIO-PROTOCOLJuly 20, 2023Laura V. Heeb, Betül Taskoparan, Antonios Katsoulas, Michal Beffinger, Pierre-Alain Clavien, Sebastian Kobold, Anurag Gupta, Johannes Vom Berg(Promega, catalog number: V3125)DNA dye (gel loading dye Purple 6×) (New England BioLabs, catalog number: B7024S)Restriction enzyme (HindIII) (New England Biolabs, catalog number: R0104T)Restriction enzyme buffer

(7) Genome-wide screening in pluripotent cells identifies Mtf1 as a suppressor of mutant huntingtin toxicityNature CommunicationsJuly 5, 2023Giorgia Maria Ferlazzo, Anna Maria Gambetta, Sonia Amato, Noemi Cannizzaro, Silvia Angiolillo, Mattia Arboit, Linda Diamante, Elena Carbognin, Patrizia Romani, Federico La Torre, et al.performed on agarose gel at 2.5%, loading 20 μL of PCR products with Purple Loading Dye 6x (NEB, cat. B7024S). β-Actin was used as loading control. Results were digitally acquired by VWR Imager CHEMI Premium. Generation

(8) In vitro Selection and in vivo Testing of Riboswitch-inspired AptamersBIO-PROTOCOLJuly 5, 2023Michael G. Mohsen, Ronald R. Breaker(New England Biolabs, catalog number: N0551S)Purple gel loading dye (6×) (New England Biolabs, catalog number: B7024S)Sodium acetate (NaOAc) (Sigma, catalog number: 241245)Sodium hydroxide (NaOH) pellets (J.T. Baker, catalog

(9) Protocol to prepare doubly labeled fluorescent nucleosomes for single-molecule fluorescence microscopySTAR ProtocolsJune 1, 2023Mohamed Ghoneim, Catherine A. MusselmanFisher Scientific,Cat# J61337.AC "Gel loading solution, 6× (for DNA agarose electrophoresis)",NEB,Cat# B7024S Gdn-HCl (guanidine hydrochloride),Millipore Sigma,Cat# G3272 Glucose (monohydrate),Ward's Science,Cat#

(10) Discovery of two new isoforms of the human DUT geneScientific ReportsMay 12, 2023Gergely Attila Rácz, Nikolett Nagy, György Várady, József Tóvári, Ágota Apáti, Beáta G. VértessyA9539) and TBE running buffer. Equally 600 ng RNA was mixed with gel loading dye (New England Biolabs, B7024S) and loaded into the wells of the gel. GeneRuler 1 kb Plus DNA Ladder (Thermo Scientific, SM1331) was

(11) Bacterial genome engineering using CRISPR RNA-guided transposasesbioRxivMarch 25, 2023Diego R. Gelsinger, Phuc Leo H. Vo, Sanne E. Klompe, Carlotta Ronda, Harris Wang, Samuel H. Sternberg(Bio-Rad, cat. no. 1610773)Gel loading dye, 6X (included with enzyme, or purchased separately: NEB cat. no. B7024S)SYBR Safe DNA gel stain (Thermo Fisher Scientific cat. no. S33102)1 kb DNA Ladder (Gold Biotechnology

(12) Tn5 tagments and transposes oligos to single-stranded DNA for strand-specific RNA sequencingGenome ResearchMarch 1, 2023Yanjun Zhang, Yin Tang, Zhongxing Sun, Junqi Jia, Yuan Fang, Xinyi Wan, Dong Fangtreated as indicated in the paper, and then the treated samples were run by 6× gel loading dye (NEB B7024S), which contained 0.48% SDS, to dissociate Tn5 with DNA. TABLE-seq A step-by-step protocol was deposited

(13) Prediction and verification of glycosyltransferase activity by bioinformatics analysis and protein engineeringSTAR ProtocolsMarch 1, 2023Dietlind L. Gerloff, Elena I. Ilina, Camille Cialini, Uxue Mata Salcedo, Michel Mittelbronn, Tanja MüllerV717A UDP-glucose,Sigma-Aldrich,Cat# U4625 Ethidium bromide,Bio-Rad,Cat#1610433EDU Gel loading dye 6×,NEB,Cat# B7024S XbaI,NEB,Cat #R0145S NotI-HF,NEB,Cat#R3189S ,, Critical commercial assays,Critical commercial assays,Critical

(14) A unified and simple medium for growing model methanogensFrontiers in MicrobiologyJanuary 10, 2023Daniel Dzofou Ngoumelah, Falk Harnisch, Snorre Sulheim, Tonje Marita Bjerkan Heggeset, Ingvild Haugnes Aune, Alexander Wentzel, Jörg Kretzschmar(Illumina Part # 15044223 Rev. B). PCR reaction products were mixed with Gel Loading Dye Purple (6X) B7024S (New England Biolabs) and checked for size and false priming issues by 0.8% agarose gel electrophoresis

(15) Use of a Bacterial Artificial Chromosome to Generate Recombinant SARS-CoV-2 Expressing Robust Levels of Reporter GenesMicrobiology SpectrumDecember 21, 2022Chengjin Ye, Luis Martinez-Sobridobuffer (Fisher Scientific, catalog no. BP1332500), 6× gel loading dye (New England Biolabs, catalog no. B7024S), ABC-HRP mouse IgG kit (Vector Laboratories, catalog no. PK-4002), agar (Oxoid, catalog no. LP0028),

(16) Production and purification of recombinant monoclonal antibodies from human cells based on a primary sequenceSTAR ProtocolsDecember 16, 2022Keith F. DeLuca, Jeanne E. Mick, Jennifer G. DeLucaE9884-500G Glacial acetic acid,Sigma,Cat# AX0073 "Gel loading dye, Purple (6×), included with REs",NEB,Cat# B7024S SYBR Safe DNA gel stain,Invitrogen,Cat# S33102 PCRBio VeriFi mix,Genesee Scientific,Cat# 17-208 Restriction

(17) Studying miRNA–mRNA Interactions: An Optimized CLIP-Protocol for Endogenous Ago2-ProteinMethods and ProtocolsNovember 30, 2022Sophie Stebel, Janina Breuer, Oliver Rossbachno.: 3030.1);DNA loading Gel Loading Dye Purple (6×) (New England Biolabs, Ipswich, MA, USA; Cat. no.: B7024S) or any other 6× TBE DNA loading buffer;GeneRuler Low-Range DNA Ladder (Thermo Fisher Scientific, Waltham,

(18) Poly ADP-ribosylation of SET8 leads to aberrant H4K20 methylation in mammalian nuclear genomeCommunications biologyNovember 25, 2022Estève PO, Sen S, Vishnu US, Ruse C, Chin HG, Pradhan S.4 °C, supernatant representing the unbound DNA was mixed with 6x purple dye (New England Biolabs # B7024S) and loaded on a 6% TBE DNA retardation gel (Thermo Fisher Scientific # EC6365BOX) at 4 °C in 0.5× TBE

(19) Polyvalent guide RNAs for CRISPR antiviralsiScienceNovember 18, 2022Rammyani Bagchi, Rachel Tinker-Kulberg, Mohammad Salehin, Tinku Supakar, Sydney Chamberlain, Ayalew Ligaba-Osena, Eric A. JosephsMedia,Sigma Aldrich,Cat#L3022 Agar,Sigma Aldrich,Cat#A1296 Gel Loading Dye,New England Biolabs,Cat#B7024S "SYBR™ Green I Nucleic Acid Gel Stain - 10,000X concentrate in DMSO",Thermo Fisher,Cat#S7563 Heat-inactivated

(20) Catalytically inactive DNA ligase IV promotes DNA repair in living cellsNucleic Acids ResearchOctober 28, 2022Noah J Goff, Manon BreniÃ¨re, Christopher J Buehl, Abinadabe J deÂ Melo, Hana Huskova, Takashi Ochi, Tom L Blundell, Weifeng Mao, Kefei Yu, Mauro Modesti, et al.Proteinase K at 1.4 mg/ml final concentration and 1× of a loading buffer containing 0.01% SDS (NEB #B7024S) and incubated for 10 min at 55°C. Samples were next resolved by 0.8% agarose gel electrophoresis in

Write a Review

(1)

11/9/2020Gel Loading Dye Purple 6x for DNA Electrophoresis Federica FiorentinoLoading Dye Purple 6x has been added to digested plasmid preparation to follow the run on agarose gel 1X