SYBR® Green JumpStart™ Taq ReadyMix™ from MilliporeSigma

Product Specs
ItemSYBR® Green JumpStart™ Taq ReadyMix™
CompanyMilliporeSigma
Price Supplier Page View Company Product Page
Catalog NumberS4438
ApplicationsVirus Characterization: RT-PCR Analysis
TypeReadyMix

Add to Compare List

MilliporeSigma

400 Summit Drive

Burlington, Massachusetts 01803

United States

Phone: (800)-645-5476
(800)-645-5439

Company Profile

Website: www.SigmaAldrich.com/

(1) Compromised diabetic heart function is not affected by miR-378a upregulation upon hyperglycemiaPharmacological ReportsDecember 1, 2023Urszula Florczyk-Soluch, Katarzyna Polak, Reece Sabo, Alicja Martyniak, Jacek Stępniewski, Józef Dulak(qPCR) as described previously [6] based on SYBR Green JumpStart Taq Ready Mix (Sigma–Aldrich, cat.no. S4438) (Table 1) or miRCURY LNA SYBR Green PCR kit (Qiagen, cat. no. 339346) (Table 2), respectively, carried

(2) Adverse bioenergetic effects of N-acyl amino acids in human adipocytes overshadow beneficial mitochondrial uncouplingRedox biologyOctober 1, 2023Herrnhold M, Hamp I, Plettenburg O, Jastroch M, Keuper M.analyzed with the CFX real-time PCR machine (Biorad) using SYBR® Green JumpStart™ Taq ReadyMix™ (Sigma, #S4438). Relative expression was analyzed using the ΔCt method. 2.7 Immunological detection of UCP1 Adipocytes

(3) BRUTUS-LIKE (BTSL) E3 ligase-mediated fine-tuning of Fe regulation negatively affects Zn tolerance of ArabidopsisJournal of Experimental BotanySeptember 29, 2023Camilla Stanton, Jorge Rodríguez-Celma, Ute Krämer, Dale Sanders, Janneke BalkqRT–PCR was carried out in 20 µl reactions using 20 ng of cDNA and SYBR® Green JumpStart™ ReadyMix™ (S4438, Sigma-Aldrich). ACTIN2 and TIP41 were used as reference genes and relative gene expression was determined

(4) A novel human fetal lung-derived alveolar organoid model reveals mechanisms of surfactant protein C maturation relevant to interstitial lung diseasebioRxivSeptember 9, 2023Kyungtae Lim, Eimear N. Rutherford, Dawei Sun, Dick J. H. Van den Boomen, James R. Edgar, Jae Hak Bang, Lydia E. Matesic, Joo-Hyeon Lee, Paul J. Lehner, Stefan J. Marciniak, et al.undertaken in 96 well plates using 4.5μl 1:10 cDNA and 10.5 μl of a master mix containing (Sigma-Aldrich, S4438) or SYBR Green PCR Master Mix (Applied Biosystems, 4309155). Primer sequences are listed in Supplementary

(5) Functionally distinct regions of the locus Leishmania major response 15 control IgE or IFNγ level in addition to skin lesionsFront ImmunolAugust 3, 2023Imtissal Krayem, Yahya Sohrabi, Helena Havelková, Elena S. Gusareva, Hynek Strnad, Marie Čepičková, Valeryia Volkova, Iryna Kurey, Jarmila Vojtíšková, Milena Svobodová, et al.acquisition using primers for the genes of interest and SYBR® Green JumpStart™ Taq ReadyMix™ (Sigma-Aldrich, S4438) for quantification. GAPDH was used as an internal control. Reactions were performed in a 384-well plate

(6) Insulin‐like growth factor binding protein‐2 and glucose‐regulated protein 78 kDa: Potential biomarkers affect prognosis in IDH ‐wildtype glioblastoma patientsCancer MedicineJuly 1, 2023Abigail J. Harland, Claire M. Perks, Paul White, Kathreena M. Kurian, Hannah R. BarberProfile, 100 μL plates (Sarstedt Ltd, 72.1981) with SYBR Green jumpstart Taq (‐20°C) ready mix (Sigma, S4438). The StepOne Plus Real‐Time PCR system (Applied Biosystems, 4376600) and StepOne software V2.3 was

(7) Hyperphagia of female UCP1-deficient mice blunts anti-obesity effects of FGF21Scientific reportsJune 24, 2023Klein Hazebroek M, Laterveer R, Kutschke M, Ramšak Marčeta V, Barthem CS, Keipert S.contained cDNA (corresponding to 5 ng of RNA), gene-specific primers (Table 1) and SybrGreen Master Mix (S4438, Sigma). Gene expression was calculated with the ΔΔCt-method using Hprt or B2m (BAT/WAT) and Hprt or

(8) The impact of metabolic endotoxaemia on the browning process in human adipocytesBMC MedicineApril 19, 2023Farah Omran, Alice M. Murphy, Awais Z. Younis, Ioannis Kyrou, Jana Vrbikova, Vojtech Hainer, Petra Sramkova, Martin Fried, Graham Ball, Gyanendra Tripathi, et al.Additional file 1, Table S1). All assays were carried out in duplicate using SYBR Green mastermix (#S4438-500RXN Sigma-Aldrich, UK), using L19 as a housekeeping control gene. Protein determination and western blot

(9) Influence of Single-Nucleotide Polymorphisms on Vitamin D Receptor Expression in Periodontal Ligament Fibroblasts as a Response to Orthodontic CompressionInternational Journal of Molecular SciencesDecember 15, 2022Erika Calvano Küchler, Agnes Schröder, Gerrit Spanier, Geraldo Thedei, Maria Beatriz Carvalho Ribeiro de Oliveira, Maria Angélica Hueb de Menezes-Oliveira, Peter Proff, Christian Kirschneckdetermine the relative expression of the VDR, a primer mix containing SYBR® Green JumpStart™ Taq ReadyMix™ (S4438, Sigma–Aldrich), the primer pairs, and 5.25 μL nuclease-free H2O (T143, Carl-Roth GmbH) were mixed with

(10) Polymer nanoparticles pass the plant interfaceNature CommunicationsNovember 30, 2022Sam J. Parkinson, Sireethorn Tungsirisurp, Chitra Joshi, Bethany L. Richmond, Miriam L. Gifford, Amrita Sikder, Iseult Lynch, Rachel K. O’Reilly, Richard M. NapierStratagene Mx3005P system (Agilent Technologies) using SYBR Green JumpStart Taq ReadyMix (Sigma Aldrich; S4438). Reactions were in 10 μl volumes containing 500 nM of each primer, 0.5× SYBR Green mix, and 1 μl of

(11) Silencing of the GluN1-NMDA Glutamate Receptor Subunit by Intranasal siRNA Increases the Latency Time for Seizures in the Pilocarpine Rodent Model of EpilepsyPharmaceuticals (Basel, Switzerland)November 26, 2022Perri RGB, Mantello AG, Rosa DS, Beleboni RO.final volume of 25 μL containing 1 μL of the cDNA (SYBR® Green JumpStart Taq ReadyMix for RT-qPCR kit # S4438-Sigma Aldrich-USA). The amplification reactions were in triplicate and taken to the thermal cycler MXPRO

(12) Effects of histamine and various histamine receptor antagonists on gene expression profiles of macrophages during compressive strainJournal of Orofacial Orthopedics / Fortschritte der KieferorthopÃ¤dieOctober 1, 2022Agnes SchrÃ¶der, Catharina Petring, Anna Damanaki, Jonathan Jantsch, Peter Proff, Christian Kirschneckwith nuclease-free water. The primer mix consisted of 7.5 µl SYBR®Green JumpStartTM Taq ReadyMixTM (S4438, Sigma-Aldrich, St. Louis, MO, USA) and 7.5 pmol of the respective primer pair (3.75 pmol/primer). All

(13) Elevated homocysteine activates unfolded protein responses and causes aberrant trophoblast differentiation and mouse blastocyst developmentPhysiological ReportsSeptember 18, 2022Nadejda Capatina, Graham J. Burton, Hong Wa Yungtranscription reaction was diluted 1:5 for subsequent qPCR using SYBR® Green JumpStart™ Taq ReadyMix™ (Sigma, S4438) or Absolute qPCR ROX Mix (Thermo Scientific, AB‐1138/B) on the MJ Research DNA Engine Opticon 2 continuous

(14) Multifaceted control of E-cadherin dynamics by the Adaptor Protein Complex 1 during epithelial morphogenesisMolecular Biology of the CellAugust 1, 2022Miguel RamÃrez Moreno, Katy Boswell, Helen L. Casbolt, Natalia A. Bulgakovaused as a template for the quantitative PCR using SYBR Green JumpStart Taq Ready Mix (Sigma-Aldrich; S4438) using a CFX96 Real-Time System (Bio-Rad) and its proprietary software. All the primers were tested

(15) Sex-dependent effects of chronic exercise on cognitive flexibility but not hippocampal Bdnf in aging miceNeuronal SignalingApril 29, 2022Annabel K. Short, Viet Bui, Isabel C. Zbukvic, Anthony J. Hannan, Terence Y. Pang, Jee Hyun KimViia 7 Real-Time PCR system (Applied Biosystems, CA, U.S.A.). Reactions were made using: SYBR Green, 10 μl (S4438, Sigma–Aldrich, Australia), ROX reference dye 0.2 μl (12223-012, Invitrogen), forward and reverse primers

(16) STRAP and NME1 Mediate the Neurite Growth-Promoting Effects of the Neurotrophic Factor GDF5SSRN Electronic JournalApril 4, 2022Jayanth Anantha, Sean Wyatt, Aideen Sullivan, Gerard O'KeeffeThe synthesized c-DNA was used for real time PCR using the Jump start SYBR green kit (Sigma; cat no. S4438). The primers used were as follows Hes5 FW: 5’ CGCATCAACAGCAGCATCGAG 3’ RV: 5’ GACGAAGGCTTTGCTGTGCT

(17) HEARTBREAK Controls Post-Translational Modification of INDEHISCENT to Regulate Fruit Morphology in CapsellaSSRN Electronic JournalMarch 29, 2022Yang Dong et al.SuperScript IV First-Strand Synthesis System ThermoFisher 18091050 SYBR Green JumpStart Taq ReadyMix Sigma-Aldrich S4438 Recombinant DNA pHTB:GUS This Paper N/A pHTB:HTB This Paper N/A pHTB:HTB:GFP This Paper N/A pHTB:AtSPF1/ASP1 This

(18) NUCB2/Nesfatin-1 Reduces Obesogenic Diet Induced Inflammation in Mice Subcutaneous White Adipose TissueNutrientsMarch 28, 2022Seley Gharanei, Manjunath Ramanjaneya, Aaran Hitesh Patel, Vanlata Patel, Kiran Shabir, Callum Auld, Emmanouil Karteris, Ioannis Kyrou, Harpal Singh RandevaFisher Scientific, Hampton, NH, USA) or SYBR Green technology (SYBR Green Jump start taq ready mix, S4438, Merck). Details of the Taqman gene expression assays and qPCR primers are presented in Table 1. The

(19) Effect of crystallinity and related surface properties on gene expression of primary fibroblastsRSC AdvancesJanuary 28, 2022Dorota Kołbuk, Marzena Ciechomska, Oliwia Jeznach, Paweł Sajkiewiczaccording to the manufacturer's protocol. Specific primers and SYBR® Green JumpStart™ Taq ReadyMix™ (S4438, Sigma) or TaqMan® Gene Expression Master Mix (Thermos Fisher Scientific) probes and TaqMan™ Gene Expression

(20) Identification of the Cysteine Protease Legumain as a Potential Chronic Hypoxia-Specific Multiple Myeloma Target GeneCellsJanuary 15, 2022Clees AS, Stolp V, Häupl B, Fuhrmann DC, Wempe F, Seibert M, Weber S, Banning A, Tikkanen R, Williams R, et al.5-fold diluted cDNA in a 25 μL reaction using SYBR® Green JumpStart™ Taq ReadyMix™ (Sigma-Aldrich, #S4438). The annealing temperature was 60 °C for all PCR reactions. Primers are listed in Table 1. The reference

Be the First to Write a Review!

SYBR® Green JumpStart™ Taq ReadyMix™ from MilliporeSigma

MilliporeSigma

Citations (126)

Reviews

SYBR® Green JumpStart™ Taq ReadyMix™ from MilliporeSigma

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map