Anti-WHSC1/NSD2 antibody [29D1] ab75359 from Abcam

Product Specs
ItemAnti-WHSC1/NSD2 antibody [29D1]
CompanyAbcam
Price Pricing Info Supplier Page View Company Product Page
Catalog Numberab75359
Antibody TypePrimary
Quantity10 UG, 100 UG
ClonalityMonoclonal
IsotypeIgG2b
HostMouse, Nude mouse
Conjugate/TagUnconjugated
ApplicationsImmunohistochemistry (Formalin/PFA-fixed paraffin-embedded sections), Immunoprecipitation, Western blot, Immunohistochemistry (Formalin/PFA-fixed paraffin-embedded sections), Immunoprecipitation, Western blot
Clone29D1
Concentration1 mg/ml
Research AreaEpigenetics
Gene NameNsd2
ReactivityHuman
TargetWHSC1/NSD2

Add to Compare List

Abcam

Discovery Drive

Cambridge Biomedical Campus

Cambridge CB2 0AX

United Kingdom

Phone: +44 (0) 1223 696000 (option 1)
+44 (0) 1223 696000 (option 2)
+44 (0) 1223 771600

Company Profile

Website: http://www.abcam.com

(1) Association of WHSC1/NSD2 and T-cell infiltration with prostate cancer metastasis and prognosisSci RepDecember 7, 2023Qiheng Li, Jiang Zhu, Yang Zhang, Yun Pan, Zhengjin Li, Min Wang, Yixuan Gao, Dongmei Feng, Xiaoyong He, Chunmei Zhangserum, the sections were incubated with corresponding primary antibodies (anti-NSD2: Abcam, 1:400, #ab75359; anti-CD4: Maixin, RMA-0620, ready‑to‑use; anti-CD8: Maixin, MAB-0021, ready‑to‑use) at 4 °C overnight.

(2) Discovery of a First-in-Class Degrader for Nuclear Receptor Binding SET Domain Protein 2 (NSD2) and Ikaros/AiolosJournal of Medicinal ChemistryAugust 11, 2022Fanye Meng, Chenxi Xu, Kwang-Su Park, H. Ümit Kaniskan, Gang Greg Wang, Jian Jinpurchased from Selleck Chemical. Antibodies used for Western blot included mouse anti-NSD2 (Abcam, ab75359), rabbit anti-GAPDH (Cell Signaling Technology, no. 5174), rabbit anti-IKZF1 (Cell Signaling Technology,

(3) NSD1 mediates antagonism between SWI/SNF and polycomb complexes and is required for transcriptional activation upon EZH2 inhibitionMolecular cellJuly 7, 2022Drosos Y, Myers JA, Xu B, Mathias KM, Beane EC, Radko-Juettner S, Mobley RJ, Larsen ME, Piccioni F, Ma X, et al.anti-NSD1,"Antibodies, Inc.",Cat#75-280; RRID: AB_11001827 Mouse monoclonal anti-NSD2 29D1,Abcam,Cat#ab75359; RRID: AB_1310816 Rabbit monoclonal anti-NSD3 D4N9N,Cell Signaling,"Cat# 92056, RRID:AB_2800178" Rabbit

(4) Histone methyltransferase WHSC1 loss dampens MHC-I antigen presentation pathway to impair IFN-γ-stimulated antitumor immunityThe Journal of clinical investigationApril 15, 2022Ren J, Li N, Pei S, Lian Y, Li L, Peng Y, Liu Q, Guo J, Wang X, Han Y, et al.in Supplemental Tables 1 and 3, respectively. The following antibodies were used: WHSC1/NSD2 (Abcam, ab75359, clone 29D1); anti–human MHC-I heavy chain (Origene, AM33035PU-N, clone HC10); and CD8 (Abcam, ab209775,

(5) Nuclear TIGAR mediates an epigenetic and metabolic autoregulatory loop via NRF2 in cancer therapeutic resistanceActa pharmaceutica Sinica. BApril 1, 2022Wang H, Wang Q, Cai G, Duan Z, Nugent Z, Huang J, Zheng J, Borowsky AD, Li JJ, Liu P, et al.proteins/epitopes were used with the sources and dilution for Western blotting indicated: NSD2 [Abcam, ab75359 (29D1); 1:2000]; TIGAR (Abcam; ab37910; 1:2000; Santa cruz; sc-166291; 1:500); HK2 (Cell signaling;

(6) Targeting NSD2-mediated SRC-3 liquid–liquid phase separation sensitizes bortezomib treatment in multiple myelomaNature CommunicationsDecember 1, 2021Jing Liu et al.(1:500) (Cell Signaling Technology, #2126, Danvers, MA, USA) and anti-NSD2 antibody (1:250) (Abcam, ab75359, Cambridge, UK) overnight at 4 °C, samples were incubated with FITC-conjugated goat anti-rabbit IgG

(7) Overexpression of EZH2/NSD2 Histone Methyltransferase Axis Predicts Poor Prognosis and Accelerates Tumor Progression in Triple-Negative Breast CancerFrontiers in OncologyFebruary 16, 2021Bo Gao, Xiumin Liu, Zhengjin Li, Lixian Zhao, Yun Panwere incubated with anti-EZH2 (1:500, Cell Signaling Technology, #5246) or anti-NSD2 (1:400, Abcam, #ab75359) antibody at 4°C overnight and then labeled using an EnVision HRP Kit (Dako) at room temperature for

(8) TWIST1 and chromatin regulatory proteins interact to guide neural crest cell differentiationeLifeFebruary 8, 2021Xiaochen Fan, V Pragathi Masamsetti, Jane QJ Sun, Kasper Engholm-Keller, Pierre Osteil, Joshua Studdert, Mark E Graham, Nicolas Fossat, Patrick PL Tamα-TWIST1 (1:1000, Abcam, Cat. #ab50887), mouse monoclonal [29D1] α-WHSC1/NSD2 (1:5000, Abcam, Cat. #ab75359), rabbit polyclonal α-CHD7 (1:5000, Abcam, Cat. #ab117522), rabbit polyclonal α-CHD8 (1:10000, Abcam,

(9) WHSC1/NSD2 regulates immune infiltration in prostate cancerJournal for immunotherapy of cancerFebruary 1, 2021Want MY, Tsuji T, Singh PK, Thorne JL, Matsuzaki J, Karasik E, Gillard B, Cortes Gomez E, Koya RC, Lugade A, et al.PVDF and further incubated with human (anti-WHSC1, Abcam, ab225625) or mouse (anti-WHSC1, Abcam, ab75359) primary antibody to WHSC1 using 1:2000 dilution for C42 lysate and 1:1000 for TRAMP C2 protein lysate.

(10) PP2Cδ Controls the Differentiation and Function of Dendritic Cells Through Regulating the NSD2/mTORC2/ACLY PathwayFrontiers in immunologyJanuary 1, 2021Lv N, Jin S, Liang Z, Wu X, Kang Y, Su L, Dong Y, Wang B, Ma T, Shi L.antibody (9677S), anti-H3K27Ac antibody (8173S) were from Cell Signaling technology; anti-NSD2 antibody (ab75359), anti-Phospho-serine (ab9332), anti-ACLY (ab40793) were from Abcam; anti-CUL4B antibody (20882-1-AP)

(11) Proteosomal degradation of NSD2 by BRCA1 promotes leukemia cell differentiationCommunications biologyAugust 21, 2020Park JW, Kang JY, Hahm JY, Kim HJ, Seo SB.dilution into 1 ng/ml)), NSD2 (EpiCypher, Durham, NC; 13-0002 dilution (1:1000)), MMSET/NDS2 (Abcam, ab75359 dilution (1:1000)), APC-CD235A (eBioscience, Waltham, MA;17-9987-42), FK2 (Enzo Life Sciences, Farmingdale,

(12) Using antagonistic pleiotropy to design a chemotherapy-induced evolutionary trap to target drug resistance in cancerNature geneticsApril 1, 2020Lin KH, Rutter JC, Xie A, Pardieu B, Winn ET, Bello RD, Forget A, Itzykson R, Ahn YR, Dai Z, et al.diluted 1:1000 in 5% BSA), Mcl-1 (CST #5453 diluted 1:1000 in 5% BSA), Bcl-xL (CST #2764), Nsd2 (Abcam ab75359 diluted 1:500 in 5% BSA), Nsd3 (Abcam ab4514 diluted 1:500 in 5% BSA), LSD1 (CST #2139 diluted 1:1000

(13) The FMRP-MOV10 complex: a translational regulatory switch modulated by G-QuadruplexesNucleic acids researchJanuary 24, 2020Kenny PJ, Kim M, Skariah G, Nielsen J, Lannom MC, Ceman S.at 1:1000, anti-RPL5 (ab157099; Abcam) at 1:1000, anti-NCS1 (ab157099; Abcam) at 1:500, anti-WHSC1 (ab75359; Abcam) at 1:1000, anti-LETM1 (ab; Abcam) at 1:1000, anti-PHACTR2 (ab85262; Abcam) at 1:1000, anti-GFP

(14) The histone methyltransferase WHSC1 is regulated by EZH2 and is important for ovarian clear cell carcinoma cell proliferationBMC CancerDecember 1, 2019Machiko Kojima et al.antigen retrieval buffer (pH 9; S2367, DAKO, Glostrup, Denmark). Anti-WHSC1 antibody (dilution: 1:200; ab75359, Abcam) was added to the tissue sections and incubated overnight at 4 °C. After washing with phosphate

(15) NSD2 overexpression drives clustered chromatin and transcriptional changes in a subset of insulated domainsNature CommunicationsDecember 1, 2019Priscillia Lhoumaud et al.antibodies have been used: anti-H3 (Abcam, #ab1791, diluted 1:20,000), anti-WHSC1/NSD2 (Abcam Cat #ab75359, diluted 1:2000), anti-H3K27me3 (Millipore Cat#07-449, dilution 1:20,000), anti-H3K36me2 (Active Motif

(16) PTEN Methylation by NSD2 Controls Cellular Sensitivity to DNA DamageCancer discoverySeptember 1, 2019Zhang J, Lee YR, Dang F, Gan W, Menon AV, Katon JM, Hsu CH, Asara JM, Tibarewal P, Leslie NR, et al.(A-4914) were purchased from Sigma. Anti-HA (MMS-101P) was obtained from Covance. Anti-MMSET/NSD2 (ab75359) and anti-MDC1 (ab41951 and ab11171) were purchased form the Abcam. Anti-53BP1 (612523) was obtained

(17) Histone methyltransferase NSD2 mediates the survival and invasion of triple-negative breast cancer cells via stimulating ADAM9-EGFR-AKT signalingActa Pharmacologica SinicaAugust 1, 2019Jun-Jian Wang, June X. Zou, Hong Wang, Zhi-Jian Duan, Hai-Bin Wang, Peng Chen, Pei-Qing Liu, Jian-Zhen Xu, Hong-Wu Chenproteins were used with the sources and dilution ratios indicated in parentheses: NSD2 (29D1, Abcam; ab75359; 1:2000); EGFR (Cell Signaling; #4267; 1:2000); β-actin (Santa Cruz; sc-47778; 1:2000); phosphor-EGFR

(18) Knockdown of Histone Methyltransferase WHSC1 Induces Apoptosis and Inhibits Cell Proliferation and Tumorigenesis in Salivary Adenoid Cystic CarcinomaAnticancer ResearchJune 1, 2019CHAO LIU, YU-HANG JIANG, ZE-LIANG ZHAO, HAI-WEI WU, LING ZHANG, ZHIJIAN YANG, ROBERT M. HOFFMAN, JIA-WEI ZHENGendogenous peroxidase blockage. Samples were then incubated with the following antibodies: antiWHSC1 (ab75359, Abcam, Cambridge, UK), anti-cleaved caspase3 (9661, Cell Signaling Technology, Boston, USA), anti-Ki67 2730 Reverse TCAGACACTCCGAATCAAA GGAAGATGGTGATGGGATT CATCCCAGCCTCCGTTAT AAAAGGCCCCTACAGTTACCA CCCATCCCTTCGTCGTCCT CCAGCCCATGATGGTTCTGAT GGCAGCGTGTACTTATCCTTCT CTGCGTAGTTGTGCTGATGT Reverse TTAGCAGAGCGTAGTGGC CCAATAATCCAGTGTCCCTA CCGTGTATGTGGGAGTGT AGGAGGGCTCTTTCTTTC GGATAAATGAAGGCAGGAC GACTTCTGCGAATACCGG CGGTTATCGTACCCTGTTC GAGTGGGATGCGGGAGAT (GB13030-2,

(19) Wolf-Hirschhorn Syndrome-Associated Genes Are Enriched in Motile Neural Crest Cells and Affect Craniofacial Development in Xenopus laevisFrontiers in PhysiologyApril 12, 2019Alexandra Mills, Elizabeth Bearce, Rachael Cella, Seung Woo Kim, Megan Selig, Sangmook Lee, Laura Anne Lowerywith EDTA, Roche). Blotting for Whsc2 was carried out using mouse monoclonal antibody to Whsc2 (Abcam, ab75359, dilution 1:3,000). Tacc3 start site MO was validated as previously described (Monsoro-Burq, 2015).

(20) An activating mutation of the NSD2 histone methyltransferase drives oncogenic reprogramming in acute lymphocytic leukemiaOncogeneJanuary 1, 2019Alok Swaroop et al.bound fractions were resolved by SDS-PAGE, and immunoblotting with antibodies to NSD2 (Abcam, Cat# ab75359) and H3 (Cell signaling Cat# 14269S) was performed to evaluate the fraction of NSD2 bound. Immunoblot

Be the First to Write a Review!

Anti-WHSC1/NSD2 antibody [29D1] from Abcam

Abcam

Citations (31)

Reviews

Anti-WHSC1/NSD2 antibody [29D1] from Abcam

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map