Fig 1: Expression of GPR87 in accumulated basal progenitor cells within the idiopathic pulmonary fibrosis (IPF) lung. a) Uniform manifold approximation and projection (UMAP) visualisation shows unsupervised transcriptome clustering, revealing nine distinct cell clusters. Heatmap shows the highest expressed marker genes of each cluster. b) UMAP visualisation showing distribution of healthy donor and IPF cells to different clusters. c) Volcano plot of differentially expressed genes (red, log2 fold change (FC) >0.6, q<0.05) in IPF EpCAM+ epithelial cells compared with donor samples, zooming in gene sets with top-15 fold change and top-15 fold change genes related to transmembrane signalling receptor activity (GO:0004888). d) Heatmap of transmembrane signalling receptor genes robustly regulated in the (supra)basal cell population across all individual tissue samples. Dotplots show GPR87 expression in our (e) and another two publicly available datasets [6, 8] (f), respectively. g) GPR87 mRNA was detected by RNAscope (Advanced Cell Diagnostics, number 471861) and combined with fluorescent immunolabelling of basal cell markers KRT5 and KRT17 in IPF lung sections (n=6) (KRT5: Biolegend 905901; KRT17: Abcam ab51056) Top row: lower magnification of a distal lung area with several remodelled airways (scale bar: 200 µm). Higher magnification of a representative cyst and a bronchiole are presented below in higher magnification (scale bar: 20 µm). KRT5+/KRT17+/GPR87+ cells are indicated by arrowheads. KRT5-/KRT17+/GPR87+ cells are indicated by open triangles. Non-cellular staining is marked by an asterisk. h) Lung tissue sections of IPF (n=3) and healthy donor (n=2) were co-immunolabelled for GPR87 (Novus Biologicals NBP2-16728) and KRT5. Nuclei are visualised by DAPI staining. Protein expression of GPR87 alone is shown in subpanel (i) and co-immunolabeled with KRT5 in (ii). Two more representative areas of remodelled airways with merged protein expression are shown in (iii) and (iv). Representative double positive cells for respective markers are indicated by arrowheads. Scale bar: 50 µm. i) Scheme of primary human bronchial epithelial cell (HBEC) isolation and air–liquid interface (ALI) culture (reproduced from Servier Medical Art (smart.servier.com) with permission). HBECs were isolated from healthy donors (n=3) and cultured on rat-tail collagen type I under submerged conditions, either transduced with lentivirus (empty vector (Origene, PS100092) or human GPR87 ORF (Origene, RC218486L3)) (m), and/or directly transferred and cultured on collagen type IV membranes, airlifted (day 0) and differentiated to a mature epithelium within 21 days. Transforming growth factor (TGF)-ß treatment (R&D, 240-B-002, 2 or 4 ng·mL-1) was performed at day 21 and every other day till day 28 (four times in total) (k). Shown are phase contrast images for dish cultured cells and early ALI (left, middle; scale bars: 250 µm, 100 µm), and a confocal image of acetylated tubulin (acTub) (Abcam ab24610) to visualise late ALI (mature epithelium, right; scale bar: 25 µm). j) Vertical membrane sections of mature ALI cultured HBECs were immunolabeled for GPR87, basal cell marker KRT5 and secretory cell marker MUC5AC (Abcam ab3649) (n=2). Representative double positive cells for respective markers are indicated by arrowheads. Scale bar: 25 µm. (We also observed cilia staining, as indicated by open triangles, and based on our single cell dataset ciliated cells might also express GPR87.) k) Airlifted donor HBECs were stimulated with low (2 ng·mL-1) and high (4 ng·mL-1) concentrations of TGF-ß, as described in (i). GPR87 gene expression was assessed by qPCR in five independent donor cell lines. GAPDH was used as an housekeeper gene control (huGPR87-fw (ACCTATGCTGAACCCACGC), -re (CCGTGCAGCTCGTTATTTGG); huGAPDH-fw (ACTAGGCGCTCACTGTTCTC), -re (AATACGACCAAATCCGTTGACTC)). Two-tailed Mann–Whitney test was performed to determine statistical significance. **: p<0.01. n=5. l) Functional annotation enrichment analysis of GPR87 positive correlated genes reveals several categories of airway remodelling. m) HBECs were transduced with lentivirus containing the full ORF of GPR87 to generate a stable overexpression of GPR87 (GPR87-over). Empty backbone-vector alone was used as a control (vector). Cells were cultured on ALI till day 21 and co-immunolabelled for acTub and FOXJ1 (Invitrogen 14-9965-82). DAPI and phalloidin stainings were performed to visualise nuclei and cellular integrity. Cells with no/shortened cilia are indicated by arrowheads. Representative images of n=4 are shown. Scale bar: 25 µm. Areas covered by cilia were quantified with ImageJ [17]. Two-tailed Mann–Whitney test was performed to determine statistical significance.