Anti-TLR2 antibody [T2.5] ab16894 from Abcam

Product Specs
ItemAnti-TLR2 antibody [T2.5]
CompanyAbcam
Price Pricing Info Supplier Page View Company Product Page
Catalog Numberab16894
Antibody TypePrimary
ClonalityMonoclonal
IsotypeIgG1
ApplicationsFlow Cytometry, Functional Studies
CloneT2.5
Quantity50 UG
HostMouse, Nude mouse
Conjugate/TagUnconjugated
Format0.2 µm filtered
Concentration0.1 mg/ml
Research AreaImmuno-oncology
Gene NameTLR2
ReactivityHuman, Mouse
TargetTLR2

Add to Compare List

Abcam

Discovery Drive

Cambridge Biomedical Campus

Cambridge CB2 0AX

United Kingdom

Phone: +44 (0) 1223 696000 (option 1)
+44 (0) 1223 696000 (option 2)
+44 (0) 1223 771600

Company Profile

Website: http://www.abcam.com

(1) The PLAUR signaling promotes chronic pruritusFASEB journal : official publication of the Federation of American Societies for Experimental BiologyJune 1, 2022Chen W, Li Y, Steinhoff M, Zhang W, Buddenkotte J, Buhl T, Zhu R, Yan X, Lu Z, Xiao S, et al.mouse antibody to PGP9.5 (1:300, Abcam ab8189), NeuN (1:500, Novus NBP1‐92693), TLR2 (1:300, Abcam ab16894), or Antigen Affinity‐purified polyclonal goat IgG against PLAUR (10ug/ml, AF534, R&D) in blocking solution

(2) The transmembrane adapter SCIMP recruits tyrosine kinase Syk to phosphorylate Toll-like receptors to mediate selective inflammatory outputsThe Journal of biological chemistryMay 1, 2022Liu L, Lucas RM, Nanson JD, Li Y, Whitfield J, Curson JEB, Tuladhar N, Alexandrov K, Mobli M, Sweet MJ, et al.Thermo Fisher Scientific Australia Pty Ltd. The monoclonal anti-TLR4 (mouse, #ab22048) and TLR2 antibodies (mouse, #AB16894) were from ABCAM Australia Pty Ltd. Antibodies detecting the V5-tag (mouse, MCA1360, clone number SV5-PK1)

(3) HBeAg mediates inflammatory functions of macrophages by TLR2 contributing to hepatic fibrosisBMC medicineOctober 15, 2021Xie X, Lv H, Liu C, Su X, Yu Z, Song S, Bian H, Tian M, Qin C, Qi J, et al.ab120297) was purchased from Abcam (Abcam, Cambridge, UK). Blocking antibody for TLR-3 (ab17264), TLR-2 (ab16894), and TLR-4 (ab30667) were purchased from Abcam (Abcam, Cambridge, UK). Primary antibodies for GAPDH

(4) Herbal melanin induces interleukin‑1β secretion and production by human THP‑1 monocytes via Toll‑like receptor 2 and p38 MAPK activationExperimental and Therapeutic MedicineJuly 29, 2021Adila El‑Obeid, Wesam Bin Yahya, Bader Almuzzaini, Abeer Al Tuwaijri, Maria Najdi, Adil Hassib, Sabine Matou‑nasriproduction functions through the TLR and p38 MAPK pathway, the cells were treated with anti-TLR2 (cat. no. ab16894) and anti-TLR4 (cat. no. ab13867) antibodies (both Abcam), or the p38 MAPK pharmacological inhibitor

(5) SAA1/TLR2 axis directs chemotactic migration of hepatic stellate cells responding to injuryiScienceMay 21, 2021Getachew A, Abbas N, You K, Yang Z, Hussain M, Huang X, Cheng Z, Tan S, Tao J, Yu X, et al.RRID:Addgene_80089 Anti-SAA1 antibody,EpiGentek,Cat#A70907; RRID:Addgene_80089 Anti-TLR2 antibody [T2.5],Abcam,Cat#ab16894; RRID:Addgene_80089 Anti-TLR2 antibody [EPR20302-119],Abcam,Cat#ab209216; RRID:Addgene_80089 Toll-like Receptor 2 (D7G9Z) Rabbit mAb

(6) Extracellular DJ-1 induces sterile inflammation in the ischemic brainPLoS biologyMay 1, 2021Nakamura K, Sakai S, Tsuyama J, Nakamura A, Otani K, Kurabayashi K, Yogiashi Y, Masai H, Shichita T.USA) according to the manufacturer’s protocol. Anti-TLR2 antibody (Abcam, USA, 1:50 dilution, Cat# ab16894) or anti-TLR4 antibody (Santa Cruz Biotechnology, USA, 1:50 dilution, Cat# sc-13593) was used for detecting

(7) Rs41291957 polymorphism in the promoter region of microRNA‑143 serves as a prognostic biomarker for patients with intracranial hemorrhageMolecular Medicine ReportsFebruary 23, 2021Xiaobo Yang, Zongduo Guo, Fang Cao, Zhipeng Teng, Zhijian Huang, Xiaochuan Sunmembrane was incubated overnight at 4°C with the following primary antibodies: Anti-TLR2 (cat. no. ab16894; 1:1,000; Abcam), anti-IL-16 (cat. no. ab207181; 1:1,000; Abcam) and anti-β-actin (cat. no. ab115777;

(8) Paeoniflorin inhibits the macrophage-related rosacea-like inflammatory reaction through the suppressor of cytokine signaling 3-apoptosis signal-regulating kinase 1-p38 pathwayMedicine (Baltimore)January 22, 2021Zijing Liu, Jiawen Zhang, Peiyu Jiang, Zhi Yin, Yunyi Liu, Yixuan Liu, Xiaoyan Wang, Liang Hu, Yang Xu, Wentao Liuand anti-ASK1 (1:1000, 8662 s) from Cell Signaling Technology (Beverly, MA, USA); anti-TLR2 (1:1000, ab16894) anti-LL37 (1:1000, ab180760) from Abcam (Cambridge, MA); anti-β-actin from Santa Cruz Biotechnology

(9) Complement-Mediated Differential Immune Response of Human Macrophages to Sporothrix Species Through Interaction With Their Cell Wall PeptidorhamnomannansFrontiers in immunologyJanuary 1, 2021Neves GWP, Wong SSW, Aimanianda V, Simenel C, Guijarro JI, Walls C, Willment JA, Gow NAR, Munro CA, Brown GD, et al.TLR2, TLR4, and Dectin-1 receptors, monoclonal anti-CD11b (Thermo Fisher, MA5-16528), anti-TLR2 (Abcam, ab16894), anti-TLR4 (Abcam, ab22048), and anti-Dectin-1 antibodies (35) were used, respectively. Briefly, hMDMs

(10) Zymosan promotes proliferation, Candida albicans adhesion and IL-1β production of oral squamous cell carcinoma in vitroInfectious Agents and CancerDecember 1, 2020Xu Chen, Qingqiong Luo, Jieying Ding, Meng Yang, Ruiyang Zhang, Fuxiang Chen/Tween 20 (TBST) for 1 h at room temperature and incubated with primary antibody overnight at 4 °C (TLR2, ab16894, Abcam; MyD88, ab133739, Abcam; E- Chen et al. Infectious Agents and Cancer (2020) 15:51 cadherin,

(11) Exosomes of Antler Mesenchymal Stem Cells Improve Postoperative Cognitive Dysfunction in Cardiopulmonary Bypass Rats through Inhibiting the TLR2/TLR4 Signaling PathwayStem Cells InternationalMarch 26, 2020Chun Yang, Shengnan Sun, Qi Zhang, Jia Guo, Tengfei Wu, Ying Liu, Min Yang, Yan Zhang, Yinghua PengThen, the wax pieces of hippocampal tissue were incubated with primary antibodies (anti-TLR2, Abcam, ab16894; anti-TLR4, Abcam, ab22048; anti-MyD88, Abcam, ab28763; and anti-NF-κB, Abcam, ab16502; Cambridge, UK)

(12) SCIMP is a universal Toll‐like receptor adaptor in macrophagesJournal of Leukocyte BiologyFebruary 1, 2020Lin Luo, James E. B. Curson, Liping Liu, Adam A. Wall, Neeraj Tuladhar, Richard M. Lucas, Matthew J. Sweet, Jennifer L. Stowanti-TLR4 antibody targeting TLR4 amino acids 100-200 (ab22048), TLR3 antibody (ab62566) and TLR2 antibody (ab16894), used for immunoprecipitation and Western blotting, were from Abcam (Melbourne, VIC, Australia). HRPconjugated

(13) Regulatory T Cells Condition Lymphatic Endothelia for Enhanced Transendothelial MigrationCell reportsJanuary 28, 2020Piao W, Xiong Y, Li L, Saxena V, Smith KD, Hippen KL, Paluskievicz C, Willsonshirkey M, Blazar BR, Abdi R, et al.IgG1-BV421 (RMG1–1),Biolegend,Cat# 406616; RRID:AB_2562234 Anti-human or mouse TLR2 (T2.5),Abcam,Cat# ab16894; RRID: AB_443530 Rat-anti-LTβR-PE (3C8),eBioscience,Cat# 12–5671-82; RRID: NA Rat-anti-mouse Gr-1-FITC

(14) Curcumin Down-Regulates Toll-Like Receptor-2 Gene Expression and Function in Human Cystic Fibrosis Bronchial Epithelial CellsBiological and Pharmaceutical BulletinMarch 1, 2019Niraj Chaudhary et al.3′) TLR2 IL-8 SP1 GAPDH 18srRNA FW RV FW RV FW RV FW RV FW RV AGGCGGACATCCTGAACCT GGCCAGCAAATTACCTGTGTG CTTTGGCAAAACTGCACCTT CTGGCCGTGGCTCTCTTG GCCGCTCCCAACTTACAGAA CCCATCAACGGTCTGGAACT GGCAGAGATGATGACCCTTTT TCCACTGGCGTCTTCACC CGGCTACCACATCCAAGGAA GCTGGAATTACCGCGGCT sample, and cell surface staining was performed using monoclonal mouse anti-TLR2 antibody (T2.5) (ab16894; Abcam, Cambridge, MA, U.S.A.), followed by staining with Alexa Fluor® 488 goat anti-mouse immunoglobulin

(15) Application of a TLR overexpression cell model in pyrogen detectionBiotechnology and BioengineeringFebruary 20, 2019Qing Han, Ruobi Hu, Hui Li, Zhen Lei, Xuehui Zhang, Xiuyan Yu, Qun Zhang, Yiqing Mao, Xi Wang, David M. Irwin, Gang Niu, Huanran Tanalbumin (Boehringer, Germany) in PBST for 30 min at 37°C. Primary antibodies (TLR4, ab89455, Abcam; TLR2, ab16894, Abcam; MD2, ab24182, Abcam; CD14, ab45870, Abcam) were diluted to 1:40 in blocking solution. Two‐hundred

(16) Expression of autophagy‑associated proteins in rat dental irreversible pulpitisMolecular Medicine ReportsFebruary 7, 2019Shengcai Qi et al.Next, the samples were incubated with rabbit primary antibodies against mouse TLR2 (1:50; cat. no. ab16894), TLR9 (1:100; cat. no. ab37154) and NF-κB1 (1:100; cat. no. ab32360) (all from Abcam, Cambridge, MA,

(17) Oral lichen-planus-associated fibroblasts acquire myofibroblast characteristics and secrete pro-inflammatory cytokines in response to Porphyromonas gingivalis lipopolysaccharide stimulationBMC Oral HealthDecember 1, 2018Liping Wang, Yinshen Yang, Xiaoqin Xiong, Ting Yu, Xinhong Wang, Wenxia Meng, Haiyan Wang, Gang Luo, Linhu Gewith primary anti-α-SMA (ab32575, Abcam) (1:5000), anti-vimentin (ab92547, Abcam) (1:5000), anti-TLR2 (ab16894, Abcam) (1:1000) and anti-TLR4 (ab22048, Abcam) (1:1000) at 4 °C. After washing, an HRP-conjugated

(18) Inhibitory effects of superoxide dismutase 3 on Propionibacterium acnes-induced skin inflammationScientific ReportsDecember 1, 2018Cuong Thach Nguyen, Shyam Kishor Sah, Christos C. Zouboulis, Tae-Yoon KimStaphylococcus aureus cell wall component (PGN, 77140) was purchased from Sigma-Aldrich (MO, USA). TLR-2 (ab16894), IL-18 (ab71495) antibodies were purchased from Abcam (Cambridge, UK). p-NF-κB p65 (sc-101752), NF-κB

(19) Murine macrophage TLR2-FcγR synergy via FcγR licensing of IL-6 cytokine mRNA ribosome binding and translationPloS oneJanuary 1, 2018Hunt D, Drake LA, Drake JR.

(20) The Expression of Toll-like receptors in eutopic and ectopic endometrium and its implication in the inflammatory pathogenesis of adenomyosisScientific ReportsDecember 1, 2017Caixia Jiang, Chao Liu, Jing Guo, Li Chen, Ning Luo, Xiaoyan Qu, Weihong Yang, Qing Ren, Zhongping Chengovernight with one of the following primary antibodies: anti-TLR1 (1:500, ab180798), anti-TLR2 (1:100, ab16894), anti-TLR3 (1:1000, ab62566), anti-TLR4 (1:500, ab13556), anti-TLR5 (1:1000, ab62460), anti-TLR7 (1:1000,

Be the First to Write a Review!

Anti-TLR2 antibody [T2.5] from Abcam

Abcam

Citations (24)

Reviews

Anti-TLR2 antibody [T2.5] from Abcam

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map