Anti-ATRX antibody ab97508 from Abcam

Product Specs
ItemAnti-ATRX antibody
CompanyAbcam
Price Supplier Page View Company Product Page
Catalog Numberab97508
Quantity100 UL
ApplicationsImmunocytochemistry/ Immunofluorescence, Immunohistochemistry (Formalin/PFA-fixed paraffin-embedded sections), Immunoprecipitation, Western blot
HostRabbit
Antibody TypePrimary
Conjugate/TagUnconjugated
IsotypeIgG
ClonalityPolyclonal
Concentration1 mg/ml
Research AreaEpigenetics
Gene NameATRX
ReactivityHuman, Mouse, Rat
TargetATRX

Add to Compare List

Abcam

Discovery Drive

Cambridge Biomedical Campus

Cambridge CB2 0AX

United Kingdom

Phone: +44 (0) 1223 696000 (option 1)
+44 (0) 1223 696000 (option 2)
+44 (0) 1223 771600

Company Profile

Website: http://www.abcam.com

(1) ATRX guards against aberrant differentiation in mesenchymal progenitor cellsbioRxivAugust 8, 2023Yan Fang, Douglas Barrows, Yakshi Dabas, Thomas S Carroll, William D. Tap, Benjamin A. Nacevconcentration of digitonin buffer for ATRX CUT&RUN was 0.01%. For each sample, 2 μg ATRX antibody (Abcam, ab97508) was added. Libraries were prepared using the NEB Ultra II DNA library prep kit. Samples were PCR amplified

(2) Induction of the alternative lengthening of telomeres pathway by trapping of proteins on DNANucleic acids researchJuly 21, 2023Rose AM, Goncalves T, Cunniffe S, Geiller HEB, Kent T, Shepherd S, Ratnaweera M, O'Sullivan RJ, Gibbons RJ, Clynes D.(Santa Cruz, sc-8007, 1:500), mouse anti-H3 (BioLegend, 819414, 1:100 000), rabbit anti-ATRX (Abcam, ab97508, 1:1000), mouse anti-ATRX (39F, 1:17) (40), mouse anti-alpha Tubulin (Abcam, ab7291, 1:50 000), mouse

(3) ONC201 Suppresses Neuroblastoma Growth by Interrupting Mitochondrial Function and Reactivating Nuclear ATRX Expression While Decreasing MYCNInternational journal of molecular sciencesJanuary 13, 2023Wu JC, Huang CC, Wang PW, Chen TY, Hsu WM, Chuang JH, Chuang HC.antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA). ClpX (ab168338), ATRX (ab97508), and EZH2 (ab186006) antibodies were purchased from Abcam (Cambridge, MA, USA). β-actin (sc-8432),

(4) Under-Representation of Racial Groups in Genomics Studies of Gastroenteropancreatic Neuroendocrine NeoplasmsCancer Research CommunicationsOctober 12, 2022Brendon R. Herring, Andrew Bonner, Rachael E. Guenter, Selwyn Vickers, Clayton Yates, Goo Lee, Deepti Dhall, Herbert Chen, J. Bart Roseplacing them in a pressure cooker for 10 minutes. Antibodies to Daxx (Sigma, HPA008736), Atrx (Abcam, ab97508), and Menin (Abcam, ab92443) were diluted at a 1:200, 1:700, and 1:100, respectively, in PBS augmented

(5) Atrx Deletion in Neurons Leads to Sexually-Dimorphic Dysregulation of miR-137 and Spatial Learning and Memory DeficitsSSRN Electronic JournalSeptember 19, 2022Renee Tamming, Vanessa Dumeaux, Luana Langlois, Jacob Ellegood, Lily Qiu, Yan Jiang, Jason P. Lerch, Nathalie Guylaine BérubéCorporation 019-19741; RRID:AB_839504 anti-INCENP Sigma I5283; RRID:AB_477113 anti-ATRX Abcam ab97508; RRID:AB_10680289 anti-H3K27me3 Millipore 07-449; RRID:AB_310624 anti-H3.3 Millipore 17-10245:

(6) The ATRX splicing variant c.21-1G>A is asymptomaticHuman Genome VariationSeptember 14, 2022Karin Kojima, Takahito Wada, Hiroko Shimbo, Takahiro Ikeda, Eriko F. Jimbo, Hirotomo Saitsu, Naomichi Matsumoto, Takanori Yamagatah). Protein was extracted from the patient’s lymphoblasts. The primary antibodies were rabbit anti-ATRX (ab97508) for the C-terminal region (amino acids 2211–2413) from Abcam (Eugene, OR, USA) and mouse anti-beta-actin

(7) Integrated MRI–Immune–Genomic Features Enclose a Risk Stratification Model in Patients Affected by GlioblastomaCancers (Basel)July 1, 2022Giulia Mazzaschi et al.were immunostained with anti-human IDH1-R132H antibody (H09, Ventana) or anti-human ATRX antibody (ab97508, Abcam), and incubated at 4 °C over night. CONFIRM anti-EGFR (5B7, Ventana) rabbit monoclonal antibody

(8) The chromatin remodeller ATRX facilitates diverse nuclear processes, in a stochastic manner, in both heterochromatin and euchromatinNature communicationsJune 17, 2022Truch J, Downes DJ, Scott C, Gür ER, Telenius JM, Repapi E, Schwessinger R, Gosden M, Brown JM, Taylor S, et al.(FF-Ctr, TA-Ctr and CB-Ctr) using two different antibodies (Santa Cruz H300 sc-15408 (10 µg) and Abcam ab97508 (15 µg)). In brief, 4 × 107 to 108 cells were crosslinked with 2 mM EGS at room temperature for 45 min

(9) Circular RNA mitochondrial translation optimization 1 homologue (CircMTO1) induced by zinc finger protein 460 (ZNF460) promotes oral squamous cell carcinoma progression through the microRNA miR-320a / alpha thalassemia/mental retardation, X-linked (ATRX) axisBioengineeredDecember 20, 2021Chen Zou, Xia Li, Xiaozhi Lv, Siyuan Wu, Jing Song, Zhe Tang, Hailing Luo, Haigang Wei, Yilong Ai5% skim milk powder for 60 min. The membranes were incubated with the primary antibody (ATRX, Abcam, ab97508, 1:2000) for 12 h, followed by a second antibody (Goat Anti-Rabbit IgG H&L, Abcam, ab150077, 1:500).

(10) ATRX regulates glial identity and the tumor microenvironment in IDH-mutant gliomaGenome BiologyDecember 1, 2021Husam Babikir, Lin Wang, Karin Shamardani, Francisca Catalan, Sweta Sudhir, Manish K. Aghi, David R. Raleigh, Joanna J. Phillips, Aaron A. DiazCTACTTCCGGGTCAGATTTTGA, and R: GCACCATCAGAGGAAACACC. Complete loss of ATRX protein was validated by Western blot (Abcam # ab97508). SB28ATRX-KO cells were transfected with plasmids expressing either IDH1R132H (ORIGENE, CAT#: RC400096)

(11) Cardiac proteomics reveals sex chromosome-dependent differences between males and females that arise prior to gonad formationDevelopmental CellNovember 1, 2021Wei Shi et al.polyclonal anti-Dystrophin (Dmd),Abcam,Cat# ab15277; RRID: AB_301813 Rabbit polyclonal anti-Atrx,Abcam,Cat# ab97508; RRID: AB_10680289 Rabbit polyclonal anti-A1bg,Abcam,Cat# Ab231805 Rabbit polyclonal anti-A1bg,Sigma,Cat#

(12) Atrx Deletion in Neurons Leads to Sexually Dimorphic Dysregulation of miR-137 and Spatial Learning and Memory DeficitsCell ReportsJune 30, 2020Renee J. Tamming, Vanessa Dumeaux, Yan Jiang, Sarfraz Shafiq, Luana Langlois, Jacob Ellegood, Lily R. Qiu, Jason P. Lerch, Nathalie G. Bérubébuffer and sonicated. Immunoprecipitation was performed with the following antibodies: anti-ATRX (Abcam, ab97508), anti-H3K27me3 (Millipore, 07-449), anti-H3.3 (Millipore, CS207327). Rabbit IgG (Cell Signaling) was

(13) Molecular Aberrations Associated with Seizure Control in Diffuse Astrocytic and Oligodendroglial TumorsNeurologia medico-chirurgicaMarch 15, 2020Hime SUZUKI et al.sections. We used antibodies against the following antigens: IDH-1 (H09, Dianova, Hamburg, Germany), ATRX (ab97508, Abcam, Cambridge, MA, USA), p53 (DO-7, BioGenex, Fremont, CA, USA), Olig2 (polyclonal, IBL, Gunma,

(14) MYCN amplification and ATRX mutations are incompatible in neuroblastomaNature communicationsFebruary 14, 2020Zeineldin M, Federico S, Chen X, Fan Y, Xu B, Stewart E, Zhou X, Jeon J, Griffiths L, Nguyen R, et al.primary antibody overnight at 4 °C. The following antibodies were used: rabbit anti-ATRX (1:1000, Abcam, ab97508), mouse anti-MYCN (1:1000, Santa cruz Biotechnology, sc-53993), rabbit anti-GAPDH (1:2500, Abcam ab-9485),

(15) Long interspersed element-1 ribonucleoprotein particles protect telomeric ends in alternative lengthening of telomeres dependent cellsNeoplasiaFebruary 1, 2020Thomas Aschacher et al.TRF-78, ab10579), TIN2 (Abcam, ab197894), POT1 (Abcam, ab90552), RAP1 (Abcam, ab40144), ATRX (Abcam, ab97508), TopoIIIα (SantaCruz, sc13060, rabbit polyclonal), DAXX (Abcam, ab32140), LINE-1 (SantaCruz H110, sc67197,

(16) ATRX affects the repair of telomeric DSBs by promoting cohesion and a DAXX-dependent activityPLoS biologyJanuary 1, 2020Lovejoy CA, Takai K, Huh MS, Picketts DJ, de Lange T.following primary antibodies were used: ATRX (Santa Cruz Biotechnology, Dallas, TX, H-300 or Abcam, ab97508), DAXX (MilliporeSigma, D7810), SA1 (Abcam, ab4457), SA2 (Abcam, ab201451), TRF1 (de Lange #1449), MCM2

(17) ATRX In-Frame Fusion Neuroblastoma Is Sensitive to EZH2 Inhibition via Modulation of Neuronal Gene SignaturesCancer cellNovember 11, 2019Qadeer ZA, Valle-Garcia D, Hasson D, Sun Z, Cook A, Nguyen C, Soriano A, Ma A, Griffiths LM, Zeineldin M, et al.second fraction starting at 0.35 column volume were immunoblotted with antibodies against ATRX (Abcam ab97508), DAXX (Santa Cruz sc-7152), EZH2 (Cell Signaling 5246), BAF155 (Santa Cruz sc-9746), and BAF47 (Bethyl

(18) Phosphorylation of histone H3.3 at serine 31 promotes p300 activity and enhancer acetylationNature GeneticsJune 1, 2019Sara Martire, Aishwarya A. Gogate, Amanda Whitmill, Amanuel Tafessu, Jennifer Nguyen, Yu-Ching Teng, Melodi Tastemel, Laura A. BanaszynskiAbcam, Lot # GR296764–8), HIRA (WC15/WC119 hybridoma), DAXX (07–471, Millipore, Lot # 2841952), ATRX (ab97508, Abcam, Lot # GR267227–8), Oct4 (sc-5279, Santa Cruz, Lot # C3109), anti-mouse IgG-HRP (NA93V, GE, Lot

(19) Role for a Filamentous Nuclear Assembly of IFI16, DNA, and Host Factors in Restriction of Herpesviral InfectionMBioJanuary 22, 2019Merkl PE, Knipe DM.11377-1-AP "Sp100, mouse",Millipore MABC1037 "Lamin B1, rabbit",Abcam ab16048 "ATRX, rabbit",Abcam ab97508 "Pol II, unphosphorylated CTD, rabbit",Abcam ab26721 "Pol II phosphor S2, rabbit",Abcam ab5095 "GAPDH,

(20) ATRX promotes maintenance of herpes simplex virus heterochromatin during chromatin stresseLifeNovember 22, 2018Joseph M Cabral, Hyung Suk Oh, David M Knipesapiens),U2OS,American Type Culture Collection,HTB-96, Antibody,"Anti-ATRX, rabbit polyclonal",Abcam,ab97508,1:500 IF; 1:2000 WB; 6 µg/ChIP rxn Antibody,"Anti-IFI16 [IFI-230], mouse monoclonal",Abcam,ab50004,1:2500

Be the First to Write a Review!

Anti-ATRX antibody from Abcam

Abcam

Citations (30)

Reviews

Anti-ATRX antibody from Abcam

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map