CXCL12/SDF-1 Antibody AF-310-NA from R&D Systems, a Bio-Techne Brand

Product Specs
ItemCXCL12/SDF-1 Antibody
CompanyR&D Systems, a Bio-Techne Brand
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberAF-310-NA
NCBI Gene AliasesIRH, PBSF, SCYB12, SDF1, TLSF, TPAR1
ApplicationsWestern Blot, Neutralization
Conjugate/TagUnconjugated
HostGoat
TargetCXCL12/SDF-1
FormatLyophilized from a 0.2 µm filtered solution in PBS with Trehalose. *Small pack size (SP) is supplied either lyophilized or as a 0.2 µm filtered solution in PBS
ReactivityHuman
IsotypeIgG
Quantity100 ug (also 25 ug)
NCBI Full Gene NameC-X-C motif chemokine ligand 12
ClonalityPolyclonal
ImmunogenE. coli-derived recombinant human CXCL12/SDF-1 alpha, Lys22-Lys89, Accession # Q6ICW0
ConcentrationLYOPH
PurityAntigen Affinity-purified
Brand/TrademarkR&D Systems, a Bio-Techne Brand
Antibody TypePrimary Antibodies
StorageUse a manual defrost freezer and avoid repeated freeze-thaw cycles. 12 months from date of receipt, -20 to -70 °C as supplied. 1 month, 2 to 8 °C under sterile conditions after reconstitution. 6 months, -20 to -70 °C under sterile conditions after reconstitution

Specifications/Features

Available conjugates: Unconjugated

Specificity: Detects human CXCL12/SDF-1 in direct ELISAs and Western blots

Add to Compare List

R&D Systems, a Bio-Techne Brand

614 McKinley Place N.E.

Minneapolis, Minnesota 55413

United States

Phone: 1 (800) 343-7475
1 (612) 379-2956

Fax: 1 (612) 656-4400

Company Profile

Website: http://www.rndsystems.com

(1) Chemokine mediated signalling within arteries promotes vascular smooth muscle cell recruitmentCommunications biologyDecember 4, 2020Stratman AN, Burns MC, Farrelly OM, Davis AE, Li W, Pham VN, Castranova D, Yano JJ, Goddard LM, Nguyen O, et al.(SantaCruz; #sc-365805; 1:500 dilution); CXCR4 (Sigma, #SAB3500383; 1:1000); CXCL12 (R&D Systems, #AF-310-NA, 1:1000). WISH probes utilized include klf2a20, pdgfba83, cxcr4a55,60, and cxcl12b (Primers FW: GAGCTCTGGACACTCGCTGT;

(2) Titanium salts tested in reconstructed human skin with integrated MUTZ-3-derived Langerhans cells show an irritant rather than a sensitizing potentialContact dermatitisNovember 1, 2020Rodrigues Neves CT, Spiekstra SW, de Graaf NPJ, Rustemeyer T, Feilzer AJ, Kleverlaan CJ, Gibbs S.goat antihuman CCL5 (AF‐278‐NA; R&D systems, Minneapolis, Minnesota), 7 μg/mL goat antihuman CXCL12 (AF‐310‐NA, R&D systems), or 7 μg/mL polyclonal goat immunoglobulin G (IgG)G isotype antibody (6‐001‐F, R&D systems)

(3) Estrogen receptor α promotes lung cancer cell invasion via increase of and cross‐talk with infiltrated macrophages through the CCL2/CCR2/MMP9 and CXCL12/CXCR4 signaling pathwaysMolecular OncologyAugust 1, 2020Miao He, Weiwei Yu, Chawnshang Chang, Hiroshi Miyamoto, Xiaohong Liu, Ke Jiang, Shuyuan YehAbcam (Cambridge, MA, USA). The anti‐mouse ERα (E115) for western blot was from Abcam. The CXCL12 (AF‐310‐NA) antibody for western blot was from R&D Systems (Minneapolis, MN, USA). Anti‐mouse/anti‐rabbit secondary

(4) Platelets Fuel the Inflammasome Activation of Innate Immune CellsCell reportsMay 12, 2020Rolfes V, Ribeiro LS, Hawwari I, Böttcher L, Rosero N, Maasewerd S, Santos MLS, Próchnicki T, Silva CMS, Wanderley CWS, et al.

(5) Receptor-Ligand Interaction Mediates Targeting of Endothelial Colony Forming Cell-derived Exosomes to the Kidney after Ischemic InjuryScientific reportsNovember 5, 2018Viñas JL, Spence M, Gutsol A, Knoll W, Burger D, Zimpelmann J, Allan DS, Burns KD.

(6) Transcriptional and translational‐uncoupling in regulation of the CXCL12 and its receptors CXCR4, 7 in THP‐1 monocytes and macrophagesImmunity, Inflammation and DiseaseMarch 1, 2018Lu Yu, Liangli Yu, Quynhchi Pham, Thomas T. Y. Wangisotype control, human CD14 blocking antibody (Cat #MAB3832), human CXCL12 neutralizing antibody (Cat #AF‐310‐NA) and human CXCL12/SDF‐1α Immunoassay ELISA kit (Cat #DSA00) were purchased from R&D Systems Inc (Minneapolis,

(7) Evidence of lateral transmission of aggressive features between different types of breast cancer cellsInternational Journal of OncologyNovember 1, 2017Nancy Adriana Espinoza-Sánchez, Eduardo Vadillo, Juan Carlos Balandrán, Alberto Monroy-García, Rosana Pelayo, Ezequiel M. Fuentes-PananáHA-CMs, 0.5 µg/ml of the goat anti-human CXCL12/SDF-1 neutralizing antibody (R&D Systems, Inc., ref. AF-310-NA) were added according to the guideline provided by the manufacturer. After 24 h of incubation at 37°C,

(8) A meta-analysis of CXCL12 expression for cancer prognosisBritish Journal of CancerJune 27, 2017Harsh Samarendra, Keaton Jones, Tatjana Petrinic, Michael A Silva, Srikanth Reddy, Zahir Soonawalla, Alex Gordon-Weeks(?) ? Assay Gate (Ijamsville, MD, USA) R&D Systems (MAB350) ? R&D Systems Abcam R&D Systems AF-310-NA Abcam (Cambridge, UK) R&D Systems Bio-Rad Laboratories (Hercules, CA, USA) (Bio-Plex 220 assay) R&D

(9) MUTZ-3 Langerhans Cell maturation and CXCL12 independent migration in reconstructed human gingivaALTEXJanuary 1, 2016Ilona J Kosten, Sander W Spiekstra, Tanja D de Gruijl, Susan GibbsELISA analysis. CXCL12 neutralization assays For blocking experiments 7 μg/ml goat anti-human CXCL12 (AF-310-NA, R&D Systems, Minneapolis, MN, USA) was added to the culture medium of SE-LC or GE-LC 30 min prior to

(10) Dual targeting of the chemokine receptors CXCR4 and ACKR3 with novel engineered chemokinesThe Journal of biological chemistrySeptember 11, 2015Hanes MS, Salanga CL, Chowdry AB, Comerford I, McColl SR, Kufareva I, Handel TM.

(11) Identification and characterization of circulating variants of CXCL12 from human plasma: effects on chemotaxis and mobilization of hematopoietic stem and progenitor cellsStem cells and developmentAugust 15, 2014Richter R, Jochheim-Richter A, Ciuculescu F, Kollar K, Seifried E, Forssmann U, Verzijl D, Smit MJ, Blanchet X, von Hundelshausen P, et al.fractions 26 and 27 were *50 ng/ mL in the blood. For the detection of CXCL12 IR, a polyclonal IgG (AF-310-NA; R&D systems) immunized against CXCL12[22–89] was used, indicating that in addition to intact CXCL12[22–88]

(12) COUP-TFI modifies CXCL12 and CXCR4 expression by activating EGF signaling and stimulates breast cancer cell migrationBMC cancerJune 6, 2014Boudot A, Kerdivel G, Lecomte S, Flouriot G, Desille M, Godey F, Leveque J, Tas P, Le Dréan Y, Pakdel F.samples. Methods Antibodies and reagents A goat polyclonal antibody against human CXCL12 (R&D Systems AF-310-NA), rabbit polyclonal antibody against CXCR4 (Abcam Inc. ab2074), mouse monoclonal antibody against human

(13) Lymphatic specific disruption in the fine structure of heparan sulfate inhibits dendritic cell traffic and functional T cell responses in the lymph nodeJournal of immunology (Baltimore, Md. : 1950)March 1, 2014Yin X, Johns SC, Kim D, Mikulski Z, Salanga CL, Handel TM, Macal M, Zúñiga EI, Fuster MM.antibodies: anti-CCL21 (R&D, MAB3661, 1:100), anti-CCR7 (Novus, St. Charles, MO; 1:250), anti-CXCL12 (R&D, AF-310-NA, 1:100), and anti-CXCR4 (R&D, MAB172, 1:200). Purification of HS from hLEC Purification of HS was

(14) A paracrine network regulates the cross-talk between human lung stem cells and the stromaNature communicationsJanuary 1, 2014Ruiz EJ, Oeztuerk-Winder F, Ventura JJ.conditioned medium was preincubated with 5 μg ml−1 of anti-human SDF-1/CXCL12 antibody (R&D Systems, #AF-310-NA) or control IgG antibody for 60 min and then added to each well. Fibroblast and HUVEC proliferation A

(15) Neuroblastoma-derived TGF-β1 modulates the chemokine receptor repertoire of human resting NK cellsJournal of immunology (Baltimore, Md. : 1950)May 15, 2013Castriconi R, Dondero A, Bellora F, Moretta L, Castellano A, Locatelli F, Corrias MV, Moretta A, Bottino C.

(16) Aberrant proliferation in CXCR7+ endothelial cells via degradation of the retinoblastoma proteinPloS oneJanuary 1, 2013Totonchy JE, Osborn JM, Botto S, Clepper L, Moses AV.(12013819011). Recombinant human SDF-1/CXCL12 (350-NS-050) and neutralizing antibodies against SDF-1/CXCL12 (AF-310-NA) and ITAC/CXCL11 (AF260) and biotinylated MouseIgG2a-anti-CXCR4 antibody (clone 12G5, FAB170B) were

(17) CXCL12 is essential for migration of activated Langerhans cells from epidermis to dermisEuropean journal of immunologyNovember 1, 2008Ouwehand K, Santegoets SJ, Bruynzeel DP, Scheper RJ, de Gruijl TD, Gibbs S.

(18) Participation of stem cells from human cord blood in skeletal muscle regeneration of SCID miceExperimental hematologySeptember 1, 2006Brzóska E, Grabowska I, Hoser G, Stremińska W, Wasilewska D, Machaj EK, Pojda Z, Moraczewski J, Kawiak J.

(19) Functional gene expression analysis of clonal plasma cells identifies a unique molecular profile for light chain amyloidosisBloodJanuary 15, 2005Abraham RS, Ballman KV, Dispenzieri A, Grill DE, Manske MK, Price-Troska TL, Paz NG, Gertz MA, Fonseca R.

(20) A transmigratory cup in leukocyte diapedesis both through individual vascular endothelial cells and between themThe Journal of cell biologyOctober 25, 2004Carman CV, Springer TA.

Be the First to Write a Review!

CXCL12/SDF-1 Antibody

CXCL12/SDF-1 Antibody

CXCL12/SDF-1 Antibody from R&D Systems, a Bio-Techne Brand

Specifications/Features

R&D Systems, a Bio-Techne Brand

Citations (25)

Reviews

CXCL12/SDF-1 Antibody from R&D Systems, a Bio-Techne Brand

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map