GoTaq Hot Start Green Master Mix from Promega

Product Specs
ItemGoTaq Hot Start Green Master Mix
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberM5122
Quantity100 reactions
Concentration2X

Specifications/Features

Information:

Biological Source for GoTaq® Hot Start Polymerase: The enzyme is derived from bacteria. The antibody is derived
from murine cell culture.
Storage Conditions: See the Product Information Label for storage recommendations. Minimize the number of freezethaw
cycles by storing in working aliquots. Product may be stored at 4°C for up to 12 weeks. Mix well prior to use.

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) Tributyltin chloride alters the structural, genomic, and epigenomic integrity of postejaculatory mammalian spermEpigeneticsDecember 31, 2025Muhammad S. Siddique, Santosh Anand, Marie-Pierre L. Gauthier, Jason O. Brant, Michael P. Kladde, Ramji K. Bhandari, Bradford W. Daigneaultng of methyl-converted gDNA from sperm, 10 µL of Go Taq Hot-Start Green Master mix (Promega, Cat No. M5122), 0.2 µM each of forward and reverse primers, and water. PCR conditions were as follows: 95°C for 3

(2) Protocol for single-base quantification of RNA m5C by pyrosequencingSTAR ProtocolsDecember 1, 2025Akin Cayir, Yvonne Böttcherkit,Invitrogen,Cat#18080093 RNAseOUT,Thermo Fisher Scientific,Cat#10777019 GoTaq hot start green master mix,Promega,Cat#M5122 EZ RNA Methylation kit,Zymo Research,Cat#R5002 DNA LoBind tubes,Eppendorf (1.5 mL),Cat#30108051 PyroMark

(3) Amyloid precursor protein and presenilin-1 knock-in immunodeficient mice exhibit intraneuronal Aβ pathology, microgliosis, and extensive neuronal lossAlzheimers DementApril 7, 2025Pravin Yeapuri, Jatin Machhi, Emma G. Foster, Rana Kadry, Shaurav Bhattarai, Yaman Lu, Susmita Sil, Roshan Sapkota, Shefali Srivastava, Mohit Kumar, et al.performed to amplify the gene of interest (APP or PS1) using GoTaq Hot Start Green Master Mix (cat. M5123, Promega) and forward and reverse primers specific to each gene (APP for GGCGGTCACACTAACGGATG, APP rev:

(4) HIV-1 infection facilitates Alzheimer’s disease pathology in humanized APP knock-in immunodeficient miceNeuroImmune Pharmacology and TherapeuticsFebruary 10, 2025Shaurav Bhattarai, Rana Kadry, Pravin Yeapuri, Yaman Lu, Emma G. Foster, Chen Zhang, Prasanta Dash, Larisa Y. Poluektova, Santhi Gorantla, R. Lee Mosley, et al.Polymerase chain reaction (PCR) was performed to amplify the gene of interest (APP) using GoTaq Hot Start Green Master Mix (cat. M5123, Promega, Madison, WI) and forward and reverse primers specific to each gene (APP for: GGCGGTCACACTAACGGATG,

(5) Catecholaminergic dysfunction drives postural and locomotor deficits in a mouse model of spinal muscular atrophyCell reportsJanuary 28, 2025Pagiazitis JG, Delestrée N, Sowoidnich L, Sivakumar N, Simon CM, Chatzisotiriou A, Albani M, Mentis GZ.universal PCR reaction was used as follows: 12.5 μL of GoTaq Hot Start Green Master Mix (Promega, catalog #M5123), 0.5 μL of each primer (25 μM; Sigma) and 4 μL of 1:20 diluted lysed tail DNA in a final volume of

(6) Abnormal c-Fos expression in TetTag mice containing fos-EGFPFrontiers in Behavioral NeuroscienceDecember 17, 2024Jacob H. Wilmot, Tracy L. Warren, Cassiano R. A. F. Diniz, Deger Carda, Marrisa M. Lafreniere, Alex S. Nord, Brian J. WiltgenTetTag lines, or water control, were added to a PCR mix of GoTaq Hot Start Green Master Mix (Promega #M5122), Nuclease-Free water, fos-tTA (forward: ACCTGGACATGCTGTGATAA, reverse: TGCTCCCATTCATCAGTTCC) and fos-EGFP

(7) Targeting DLBCL by mutation-specific disruption of cancer-driving oncogenesFrontiers in Genome EditingOctober 14, 2024Najmeh Heshmatpour, S. Maryam Kazemi, Niklas D. Schmidt, Sarita R. Patnaik, Patrick Korus, Bodo G. C. Wilkens, Arturo Macarrón Palaciosthe targeted genomic DNA, producing a PCR amplicon of <900 bp. GoTaq® G2 Hot Start Taq Polymerase (M5122; Promega) was utilized for PCR to screen for InDels/mutations in the region of interest. The resulting

(8) PRKACB is a novel imprinted gene in marsupialsEpigenetics & ChromatinSeptember 28, 2024Trent Newman, Donna M. Bond, Teruhito Ishihara, Phoebe Rizzoli, Quentin Gouil, Timothy A. Hore, Geoff Shaw, Marilyn B. RenfreeStaufen, Germany). Genotyping the candidate DMR was performed by PCR with GoTaq Master Mix (cat. no. M5123, Promega, Madison, WI, USA) and the genotyping primers indicated (Additional File 1). The products were

(9) A study on viruses and bacteria with particular interest on Mycoplasma pneumoniae in children with exacerbation of asthma from a tertiary care hospital in Sri LankaAccess MicrobiologyJuly 30, 2024Lakmini Inoka Wijesooriya, Victoria Chalker, Priyantha Perera, N. P. Sunil-ChandraMasterMix solution (GoTaq® Hot Start Green MasterMix, 100 reactions, Promega, USA, catalogue number: M5122) was added per run as the first PCR in the nested PCR. The second (nested) PCR was run using the N2

(10) The structure of the TH/INS locus and the parental allele expressed are not conserved between mammalsHeredity (Edinb)July 1, 2024Trent Newman, Teruhito Ishihara, Geoff Shaw, Marilyn B. Renfreeprimers (Supplementary Table 2). Nested RACE experiments were performed with GoTaq Master Mix (cat. no. M5123, Promega, Madison, WI, USA) and products cloned using the pGEM-T Easy Vector System (cat. no. A1360,

(11) Identification of a Single Nucleotide Polymorphism of Vitamin D Receptor (VDR) and Vitamin D Binding Protein (VDBP) Gene and Its Dysregulated Pathway Through VDR-VDBP Interaction Network Analysis in Vitamin D-Deficient Infertile FemalesCureusMarch 5, 2024Zil E Rubab, Sumaira Naz, Mussarat Ashraf, Saba Shahid, Rehana Rehmanextension at 72 °C of 10 min. PCR was performed for VDBP using the GoTaq hot start master mix (Cat. No. M5122; Promega Corporation, Madison, WI) as per the instructions provided. PCR conditions were initial denaturation

(12) MiR-290 Family Maintains Pluripotency and Self-Renewal by Regulating MAPK Signaling Pathway in Intermediate Pluripotent Stem CellsInternational Journal of Molecular SciencesFebruary 26, 2024Yueshi Liu, Xiangnan Li, Xiaozhuang Ma, Qiankun Du, Jiemin Wang, Haiquan Yumanufacturer’s instructions. Each bisulfite-treated genome was amplified using GoTaq® Hot Start Master Mix (M5122, Promega, Madison, WI, USA) and the specific primers listed in Supplementary Table S2. Bisulfite-treated

(13) Nimbidiol protects from renal injury by alleviating redox imbalance in diabetic miceFrontiers in pharmacologyJanuary 1, 2024Juin SK, Pushpakumar S, Sen U.-polymerase chain reaction (RT-PCR) was performed to amplify cDNA using the GoTaq Hot Start Green Master Mix (cat. no. M5122, Promega, Madison, WI, USA) as per manufacturer’s instructions. After PCR amplification, the product

(14) Characterization of mRNA Signature in Milk Small Extracellular Vesicles from Cattle Infected with Bovine Leukemia VirusPathogensOctober 13, 2023Md. Matiur Rahman, Hinata Ishikawa, Marika Yamauchi, Shigeo Takashima, Yuji O. Kamatari, Kaori Shimizu, Ayaka Okada, Yasuo Inoshimareaction mixture of 20 µL containing 0.5 units of polymerase from GoTaq Hot Start Green Master Mix (M5122, Promega, Madison, WI, USA) or SapphireAmp Fast PCR Master Mix (RR350A, Takara Bio, Kusatsu, Japan),

(15) SLC20a1/PiT-1 is required for chorioallantoic placental morphogenesisVascular BiologyApril 1, 2023Ana Correia-Branco, Ariel Mei, Sreehari S Pillai, Nirmala Jayaraman, Radhika Sharma, Alison G Paquette, Naveen K Neradugomma, Ciara Benson, Nicholas W Chavkin, Qingcheng Mao, et al.buffer, as previously described (Wallingford et al. 2016 (13)). Hot Start Green Master Mix 2× (Promega, M5122) was used according to the manufacturer’s directions. Primers were purchased from IDT and included exon

(16) Identification of Suitable Internal Control miRNAs in Bovine Milk Small Extracellular Vesicles for Normalization in Quantitative Real-Time Polymerase Chain ReactionMembranesFebruary 2, 2023Rahman MM, Nakanishi R, Tsukada F, Takashima S, Wakihara Y, Kamatari YO, Shimizu K, Okada A, Inoshima Y.the reaction volume was 20 µL containing 0.5 U of polymerase from GoTaq Hot Start Green Master Mix (M5122, Promega, Madison, WI, USA), 0.5 µM each of forward and reverse primers, and 1 µL of extracted WBCs

(17) Glucosidase inhibitor, Nimbidiol ameliorates renal fibrosis and dysfunction in type-1 diabetesScientific reportsDecember 15, 2022Juin SK, Pushpakumar S, Tyagi SC, Sen U.cDNA was amplified by reverse transcriptase PCR using the GoTaq Hot Start Green Master Mix (cat. no. M5122, Promega, Madison, WI, USA) following manufacturer′s protocol. The PCR product was run on 1.5% agarose

(18) Loss of METTL3 Attenuates Blastic Plasmacytoid Dendritic Cell Neoplasm Response to PRMT5 Inhibition via IFN SignallingBlood AdvancesSeptember 27, 2022Malini Rethnam, Darren Qiancheng Tan, Shi Hao Tan, Jia Li, Rui Yokomori, Ying Li, Henry Yang, Takaomi Sanda, Toshio Sudawas synthesized as described above and amplified by PCR using Go Taq G2 Hot Start Green Master Mix (M5122; Promega). Primers flanking the intron region of interest were designed based on sites identified from

(19) A new enzyme-linked immunosorbent assay for serological diagnosis of seal parapoxvirus infection in marine mammalsJournal of Veterinary ResearchMarch 1, 2022Yassien Badr, Md. Matiur Rahman, Yoshito Ohno, Keita Ishijima, Ken Maeda, Kaoru Kohyama, Yuji O. Kamatari, Kaori Shimizu, Ayaka Okada, Yasuo Inoshimaproduct for cloned vectors. The reaction was performed using GoTaq Hot Start Green Master Mix (cat. no. M5123; Promega, Madison, WI, USA) in a Veriti thermal cycler (Applied Biosystems, Foster City, CA, USA). The

(20) Association of trinucleotide repeat polymorphisms CAG and GGC in exon 1 of the androgen receptor gene with male infertility: a cross-sectional studyTurkish Journal of Medical SciencesJanuary 1, 2022MUSSARAT ASHRAF, DR. SHAHANA UROOJ KAZMI, HEMAILA TARIQ, ADNAN MUNIR, REHANA REHMANextension of 10 min at 72 °C. PCR was performed for GGC repeats using GoTaq HotStart Master Mix (Cat# M5122, Promega, USA) as per the manufacturer’s instructions. The PCR conditions were 1 cycle for 5 min at

Be the First to Write a Review!