Maxwell 16 Blood DNA Purification Kit from Promega

Product Specs
ItemMaxwell 16 Blood DNA Purification Kit
CompanyPromega
Price Get Pricing Get Quote for this Product
Catalog NumberAS1010
Time16 samples in approximately 30 minutes.
Quantity48 preps
MethodMagneSil® Paramagnetic Particles
YieldEight replicate blood samples are tested and the yield is =3pg of genomic DNA per input white blood cell for at least 6 out of 8 replicates under these conditions.
SourceBlood, Cell/Tissue, Fixed Tissue, Tail
Nucleic Acid TypeGenomic DNA

Specifications/Features

Starting Material:
Blood

Starting Amount:
from 200µl of human blood

Add to Compare List

Promega

2800 Woods Hollow Rd.

Madison, Wisconsin

United States

Phone: 800-356-9526
Fax: 800-356-1970

Company Profile

Website: http://www.promega.com

(1) Mitochondria-wide association study observed significant interactions of mitochondrial respiratory and the inflammatory in the development of anxiety and depressionTranslational PsychiatryJune 21, 2023Li Liu, Shiqiang Cheng, Xin Qi, Peilin Meng, Xuena Yang, Chuyu Pan, Yujing Chen, Huijie Zhang, Zhen Zhang, Jingxi Zhang, et al.buffy coat at UK Biocenter (Stockport, UK) using a Promega Maxwell® 16 Blood DNA Purification Kit (AS1010). UK biobank developed a workflow for quality control (QC), imputation and analysis of mtDNA genotypes

(2) High risk APOL1 genotypes and kidney disease among treatment naÃ¯ve HIV patients at Kano, NigeriaPLOS ONEOctober 13, 2022Aliyu Abdu, Raquel Duarte, Caroline Dickens, Therese Dix-Peek, Sunusi M. Bala, Babatunde Ademola, Saraladevi Naickerfactor. Genomic DNA was extracted from whole blood using the Maxwell DNA purification kit (Promega AS1010, USA) as per the manufacturer’s protocol. DNA concentrations were determined by the NanoDropTM 2000

(3) Associated Effect of SLC40A1 and TMPRSS6 Polymorphisms on Iron OverloadMetabolitesSeptember 29, 2022Lorena Duca, Francesca Granata, Elena Di Pierro, Valentina Brancaleoni, Giovanna Graziadei, Isabella Navalymphomonocytes of peripheral blood samples using the Maxwell® 16 SEV Blood DNA Purification Kit (Catalog No. AS1010 Promega, Madison, WI, USA) following the manufacturer’s instructions. The DNA samples were stored at

(4) Association of serum surfactant protein D and SFTPD gene variants with asthma in Danish children, adolescents, and young adultsImmunity, Inflammation and DiseaseFebruary 1, 2022Benjamin Hoffmann‐Petersen, Raymond Suffolk, Jens J. H. Petersen, Thomas H. Petersen, Charlotte Brasch‐Andersen, Arne Høst, Susanne Halken, Grith L. Sorensen, Lone Agertoftgenotyping were carried out by PentaBase Aps using Maxwell® 16 Blood DNA Purification Kit (Promega, AS1010) and nuclease resistant probes, EasyBeacons™, developed by PentaBase, 27 in a 2‐step Real‐Time PCR,

(5) The Efficiency of Probiotics Administrated via Different Routes and Doses in Enhancing Production Performance, Meat Quality, Gut Morphology, and Microbial Profile of Broiler ChickensAnimals (Basel)December 20, 2021Elham A. Soumeh, Astrid Del Rocio Coba Cedeno, Shahram Niknafs, Jacoba Bromfield, Louwrens C. HoffmanFor complete genomic DNA (gDNA) extraction, microbial cells were lysed using Lysate buffer (Promega, AS1010, Madison, WI, USA) with a Qiagen TissueLyser II (Qiagen, Hilden, Germany; 30 Hz, 60 sec, 1 repetition

(6) Compound heterozygous null mutations of NOBOX in sisters with delayed puberty and primary amenorrheaMolecular Genetics & Genomic MedicineOctober 1, 2021Asma Sassi, Julie Désir, Sarah Duerinckx, Julie Soblet, Sonia Van Dooren, Maryse Bonduelle, Marc Abramowicz, Anne Delbaerewas extracted from peripheral blood leukocytes using Promega Maxwell® 16 Blood DNA Purification Kit AS1010 for WES and Promega Maxwell® RSC Whole Blood DNA Kit AS1520 for Sanger sequencing. Two mcg of DNA at

(7) NOD2/CARD15 polymorphisms (P268S, IVS8⁺¹⁵⁸, G908R, L1007fs, R702W) among Kuwaiti patients with Crohn's disease: A case-control studySaudi Journal of GastroenterologyAugust 3, 2021Hassan Abdelnaby et al.venous blood samples using a MaxwellTM instrument and a Maxwell 16 blood DNA purification kit (Cat. AS1010, for venous blood) according to the manufacturer's protocol (Promega Corporation, USA). Three common

(8) Characterization of Genetic Variants in the SLC5A5 Gene and Associations With Breast Milk Iodine Concentration in Lactating Women of African Descent: The NUPED StudyFrontiers in NutritionJuly 23, 2021Sicelosethu S. Siro, Jeannine Baumgartner, Maryke Schoonen, Jennifer Ngounda, Linda Malan, Elizabeth A. Symington, Cornelius M. Smuts, Lizelle Zandbergwas isolated from buffy coat using the Maxwell® 16 instrument and Maxwell® 16 DNA Purification Kit (AS1010) (Promega Corporation) following the manufacturer's instructions. Quantification of gDNA was done using

(9) An atlas of mitochondrial DNA genotype–phenotype associations in the UK BiobankNature GeneticsJuly 1, 2021Ekaterina Yonova-Doing, Claudia Calabrese, Aurora Gomez-Duran, Katherine Schon, Wei Wei, Savita Karthikeyan, Patrick F. Chinnery, Joanna M. M. Howsonbuffy coat at UK Biocenter (Stockport, UK) using a Promega Maxwell® 16 Blood DNA Purification Kit (AS1010). Samples with sufficient DNA concentration and purity (as measured by 260/280 ratio) were aliquoted

(10) Deciphering the genetic and epidemiological landscape of mitochondrial DNA abundanceHuman GeneticsJune 1, 2021Sara Hägg, Juulia Jylhävä, Yunzhang Wang, Kamila Czene, Felix Grassmannwas extracted from the buffy coat aliquot with the Promega Maxwell® 16 Blood DNA Purification Kit (AS1010). In this method, DNA is purified using magnetic particles which are used to capture, wash and elute

(11) Motor control and cognition deficits associated with protein carbamoylation in food (cassava) cyanogenic poisoning: Neurodegeneration and genomic perspectivesFood and Chemical ToxicologyFebruary 1, 2021F. A. Rwatambuga et al.genes Genomic DNA was extracted from the buffy coat using a Maxwell 16 Blood DNA Purification kit (Promega): AS1010 according to manufacturer’s instruction. DNA samples were immediately frozen to −80 °C and shipped on

(12) Multienzyme Super-Dosing in Broiler Chicken Diets: The Implications for Gut Morphology, Microbial Profile, Nutrient Digestibility, and Bone MineralizationAnimals (Basel)December 22, 2020Jacoba Madigan-Stretton, Deirdre Mikkelsen, Elham Assadi Soumehprocessed for gDNA extraction and purification using the Maxwell 16 blood DNA purification kit (Promega, AS1010, Madison, WI, USA) and the automated Maxwell 16 MDx instrument (Promega, Alexandria NSW, Australia),

(13) Meta-analyses of genome wide association studies in lines of laying hens divergently selected for feather pecking using imputed sequence level genotypesBMC GeneticsDecember 1, 2020Clemens Falker-Gieske, Hanna Iffland, Siegfried Preuß, Werner Bessei, Cord Drögemüller, Jörn Bennewitz, Jens Tetensconserved blood samples with the Promega Maxwell® 16 and Maxwell® Blood DNA Purification Kits (Kat# AS1010) according to the manufacturer’s protocol. For genotyping with Illumina SNP chips the concentration

(14) Sequential ctDNA whole-exome sequencing in advanced lung adenocarcinoma with initial durable tumor response on immune checkpoint inhibitor and late progressionJournal for ImmunoTherapy of CancerJune 24, 2020Etienne Giroux Leprieur et al.manufacturer’s instructions. DNA from whole blood samples (used for constitutive DNA) was extracted using AS1010 Maxwell 16 Blood DNA Purification Kit (Promega, USA), according to manufacturer’s instructions. DNA

(15) Blockade of Oncogenic NOTCH1 with the SERCA Inhibitor CAD204520 in T Cell Acute Lymphoblastic LeukemiaCell Chemical BiologyJune 1, 2020Matteo Marchesini et al.using a Promega Maxwell® kit as per the manufacturer’s protocol (Promega Corporation, Madison WI, USA, #AS1010). A total amount of 1.0 μg genomic DNA per sample was used as input material for the DNA library preparation.

(16) Molecular Detection and Biological Control of Human Hair Dandruff Causing Microorganism Staphylococcus aureusJournal of Pure and Applied MicrobiologyMarch 31, 2020Md. Atik Mas-ud et al.lysis and selective precipitation of cell debris and polysaccharides with Maxwell Blood DNA Kit (Model: AS1010) Promega, USA. The extracted DNA was resuspended in TAE buffer (Promega, USA) and quantified using a

(17) Improving sustainable use of genetic resources in biodiversity archivesPeerJFebruary 13, 2020E. J. Tuschhoff, Carl R. Hutter, Richard E. Glorfor contamination. In our study, we used the Promega blood DNA purification kit (Promega product ID: AS1010). We followed the manufacturer’s procedures (Maxwell(R) RSC Blood DNA Kit technical manual TM419; Promega,

(18) Decolourization of Textile Azo Dye Direct Red 81 by Bacteria from Textile Industry EffluentInternational Journal of Current Microbiology and Applied SciencesApril 20, 2019Sk. Md. Atiqur Rahman, Ananda Kumar Saha, Rokshana Ara Ruhi, Md. Fazlul Haque, Moni Krishno Mohantasequence analysis. Genomic DNA was extracted from the bacterial cells using Maxwell Blood DNA kit (Model: AS1010, Origin: Promega, USA).The 16S rDNA gene was amplified by PCR using the specific primers, 27F and 1492R

(19) Influence of vitamin D receptor polymorphisms on biochemical markers of mineral bone disorders in South African patients with chronic kidney diseaseBMC NephrologyDecember 1, 2018Bala Waziri, Therese Dix-Peek, Caroline Dickens, Raquel Duarte, Saraladevi Naickertechniques. Genotyping DNA was extracted from whole blood using the Maxwell DNA purification kit (Promega AS1010, USA). Using appropriate primers obtained DNA products were amplified for ApaI (Foward: 5’ CAGAGCATGGACAGGGAGCAAG

(20) CYP2D6 genotype can help to predict effectiveness and safety during opioid treatment for chronic low back pain: results from a retrospective study in an Italian cohortPharmacogenomics and Personalized MedicineNovember 15, 2018Concetta Dagostino, Massimo Allegri, Valerio Napolioni, Simona D'Agnelli, Elena Bignami, Antonio Mutti, Ron HN van Schaikfrom whole blood and collected in vacutainer with EDTA, was purified with a DNA purification Kit (cod. AS1010; Promega) using an automatic system Maxwell16 (Promega). Genomic DNAs were quantified using a NanoDrop

Be the First to Write a Review!