Amplifying human genomic DNA from whole blood
Introduction
This protocol is designed to amplify human genomic DNA from
whole blood using Finnzymes’ High Performance PCR solution.
Freshly collected blood and blood stored at 4°C or -20°C are all
suitable starting materials, and all common anticoagulants (EDTA,
heparin and citrate) can be used. Whole blood volumes up to 5 %
of the total reaction volume have shown little or no inhibition
even when amplifying large PCR products (up to 7.5 kb).
The protocol follows the standard recommendations for the
Phusion™ Flash PCR Master Mix, with simple modifications of
adding an initial 5-minute incubation step at 90°C and increasing
the number of cycles from 30 to 35. The incubation step allows
the lysis of leukocytes and makes genomic DNA available for
PCR. This protocol works well with whole blood concentrations
of 0.5-5 % in the reaction.
Materials and Methods
• Whole blood with EDTA (1.8 mg/ml), sodium citrate 3.2 % (109 mM) or heparin ( 14 I.U/ml) as anticoagulant
• Primers for 0.7 kb fragment of Beta Glucuronidase gene:
Forward GCAGTGGCGCAATCTCGTCTC Tm = 71.8°C
Reverse GGCCCAGGCTGCAACAACTTC Tm = 72.2°C
• Phusion™ Flash High-Fidelity PCR Master Mix, (Finnzymes Oy)
• Piko™ Thermal Cycler, (Finnzymes Oy)
• UTW™ tubes or plates, (Finnzymes Oy)
Pipetting instructions
Cycling instructions
* 2-step protocol is applicable when primer Tm values are at least 69-72°C as
calculated with Finnzymes’ Tm calculator. As a basic rule, for primers ≥ 20 nt,
anneal at Tm +3°C of the lower Tm primer. For primers < 20 nt use an annealing
temperature equal to the Tm of the lower Tm primer.
Example of 2-step PCR reactions with 0.5 and 5 % concentrations of whole
blood. A 0.7 kb human single copy genomic amplicon was amplified using the
recommended protocol. Blood preserved with EDTA, heparin or citrate and stored
at 4°C or -20°C was used as starting material. Fresh blood may also be used (data
not shown). In this assay the total protocol time was 27 minutes.
Note 1
For general troubleshooting guidelines, please refer to the
Phusion Flash PCR Master Mix instruction manual. Special notes
for this application are given below.
1. For some amplicons, blood preserved with citrate has proven to be
somewhat inhibitory for PCR. It may be necessary to limit blood
concentration to less than 5 %.
2. For longer amplicons (> 2 kb) greater yields may be obtained by
increasing the extension time to 20-30 s/kb. Also adding 5 cycles
may improve the results.
Note 2
Phusion and Phusion Hot Start High-Fidelity DNA Polymerases
also work well for this application, but with certain limitations.
For best results, follow the recommended protocols for the
respective enzymes, but note these additional guidelines:
1. Include the 5-minute, pre-incubation at 90°C to lyse leukocytes.
2. Limit whole blood to 1 % of total reaction volume.
3. Use Phusion GC Buffer.
4. Use 1-2 units enzyme per 50 μl reaction.
5. Up to 5 additional cycles may be required to achieve results equivalent to PCR using purified DNA as a template.
High Performance PCR
High Performance PCR combines Finnzymes’ highly processive
proofreading Phusion™ DNA Polymerases, high-speed Piko™
Thermal Cyclers, and ultra-thin walled UTW™ tubes and plates.
This solution enables the use of extremely short cycling protocols
and improves DNA amplification from difficult starting materials.
Find out more at www.highperformancepcr.com
back to top
|
