Trypsin-EDTA (0.05%), phenol red from Thermo Fisher Scientific

Product Specs
ItemTrypsin-EDTA (0.05%), phenol red
CompanyThermo Fisher Scientific
Price Pricing Info Supplier Page View Company Product Page
Catalog Number25300120
Quantity20 x 100mL
ApplicationsCELL CULTURE
Brand/TrademarkGibco™
Regulatory StatusFor Research Use Only. Not for use in diagnostic procedures

Add to Compare List

Thermo Fisher Scientific

168 Third Avenue

Waltham, MA 02451

United States

Phone: 800-678-5599

Company Profile

Website: www.thermofisher.com

(1) Protocol for measuring BRAF autoinhibition in live cells using a proximity-based NanoBRET assaySTAR ProtocAugust 16, 2023Russell Spencer-Smith, Deborah K. MorrisonMg++",Quality Biologicals,cat# 114-057-101 "Trypsin-EDTA (0.05%), phenol red",Life Technologies,cat# 25300120 "DMEM, high glucose, L-glutamine, phenol red, sodium pyruvate; without HEPES",Life Technologies,cat#

(2) Dissecting the spermatogonial stem cell niche using spatial transcriptomicsCell reportsJuly 25, 2023Rajachandran S, Zhang X, Cao Q, Caldeira-Brant AL, Zhang X, Song Y, Evans M, Bukulmez O, Grow EJ, Nagano M, et al.every 3–4 days and cells were collected at day 0, and day 7 after trypsinization (0.05% Trypsin EDTA, 25300120, Gibco). Multiparameter FACS To evaluate the presence of undifferentiated (GFRa1+) and differentiated

(3) Hardwiring tissue-specific AAV transduction in mice through engineered receptor expressionNature methodsJuly 1, 2023Zengel J, Wang YX, Seo JW, Ning K, Hamilton JN, Wu B, Raie M, Holbrook C, Su S, Clements DR, et al.and head, heart and liver were removed. PBS was removed and ~0.5 ml of trypsin-EDTA (ThermoFisher, 25300120) was added to each dish. Embryos were minced using sterile razor blades and incubated at 37 °C for 5–10

(4) A novel retinoic acid drug, EYE-502, inhibits choroidal neovascularization by targeting endothelial cells and pericytesScientific ReportsJune 27, 2023Yaming Shen, Miao Xu, Ling Ren, Xiumiao Li, Xiaoyan Han, Xin Cao, Jin Yao, Biao Yanas shown in the previous studies11,12. Briefly, choroidal tissues were digested with 0.05% trypsin (25300120, Gibco, USA) at 37 °C for 30 min. After removing RPE layers, they were digested in 5 ml of digestion

(5) Loss of AMPKα2 promotes melanoma tumor growth and brain metastasisiScienceJune 16, 2023Ping Yuan, Da Teng, Evelyn de Groot, Man Li, Sebastian Trousil, Che-Hung Shen, Jason Roszik, Michael A. Davies, Y.N. Vashisht Gopal, Bin ZhengDMEM high glucose,Gibco™,Cat#10313039 Fetal Bovine Serum - Premium,R&D systems,S11150 0.05%Trypsin-EDTA,Gibco™,Cat#25300120 Ham’s F-12,Sigma,N6658 Pen-Strep,Gibco™,Cat#15140122 L-glutamine,Gibco™,Cat#25030081

(6) Regulatory architecture of housekeeping genes is driven by promoter assembliesCell reportsMay 30, 2023Dejosez M, Dall'Agnese A, Ramamoorthy M, Platt J, Yin X, Hogan M, Brosh R, Weintraub AS, Hnisz D, Abraham BJ, et al.7.5",Invitrogen,15567–027 Tris-HCl pH 8.0,Invitrogen,15568–025 Triton X-100,Sigma-Aldrich,T8787 Trypsin-EDTA 0.05%,Gibco,25300120 Vectashield mounting medium,Vector laboratories,H-1000 Critical commercial assays,Critical commercial

(7) An mRNA-based T-cell-inducing antigen strengthens COVID-19 vaccine against SARS-CoV-2 variantsNature communicationsMay 23, 2023Tai W, Feng S, Chai B, Lu S, Zhao G, Chen D, Yu W, Ren L, Shi H, Lu J, et al.(Invitrogen, Cat. No# 32460, 1:3000). Collected cells were treated with trypsin-EDTA (Gibco, Cat. No# 25300120) to generate single cells, which were then fixed and permeabilized using Cytofix/Cytoperm reagent (BD

(8) Transposable elements activation triggers necroptosis in mouse embryonic stem cellsCell Death & DiseaseMarch 7, 2023Lingmei Jin, Jiangping He, Huijian Feng, Sa Li, He Liu, Hongzhi Dong, MingLi Hu, Junju Huang, Haoyu Wu, Jiekai Chen, et al.DC). Medium was refreshed every day and cells were passaged every 3 days using 0.05% Trypsin-EDTA (25300120, Gibco). Cells during gene editing were cultured in SL + 2i (serum LIF with 2i) medium composed as follows:

(9) Bat pluripotent stem cells reveal unusual entanglement between host and virusesCellMarch 2, 2023Marion Déjosez, Arturo Marin, Graham M. Hughes, Ariadna E. Morales, Carlos Godoy-Parejo, Jonathan L. Gray, Yiren Qin, Arun A. Singh, Hui Xu, Javier Juste, et al.washed with DPBS (Life Technologies, 14190144), treated with 0.05% trypsin-EDTA (Life Technologies, 25300120) to obtain a single cell solution and either split at a ratio of 1:4 or used directly in a reprogramming

(10) Tracking the dynamics of female germ cell development during peri-hatch periods using a gene-edited chicken modelPoultry ScienceMarch 1, 2023Liping Pu, Long Xie, Jiawen Chen, Haodong Sun, Zhenwen Huang, Tianpeng Xu, Kui Tian, Jing Zhong, Huiyan Xu, Xingting Liu, et al.DAZL–mCherry embryos were isolated at 7 dh, washed 3 times with PBS, digested using 0.05% Trypsin (Gibco, 25300120, USA) at 37°C for 8 min and inactivation by culture in a serum-containing culture medium. All ovarian

(11) Mechanical conditioning of human mesenchymal stem cells for enhancing vascular regenerationSTAR ProtocolsMarch 1, 2023Miles W. Massidda, ByungGee Im, Jason Lee, Aaron B. Bakerproteins","Chemicals, peptides, and recombinant proteins" ,, Trypsin-EDTA 0.05%,Thermo Fisher,Cat#25300120 "DMEM, low glucose, pyruvate, no glutamine, no phenol red",Thermo Fisher Scientific,Cat#11054001 Fetal

(12) Role of FGF10/FGFR2b Signaling in Homeostasis and Regeneration of Adult Lacrimal Gland and Corneal Epithelium ProliferationInvestigative Opthalmology & Visual ScienceJanuary 30, 2023Emma N. Finburgh, Olivier Mauduit, Takako Noguchi, Jennifer J. Bu, Anser A. Abbas, Dominic F. Hakim, Saverio Bellusci, Robyn Meech, Helen P. Makarenkova, Natalie A. Afshari#1243217; Sigma-Aldrich). After 4 days in culture, cells were stripped with Gibco Trypsin–EDTA (0.05%, #25300120; Thermo Fisher Scientific), and replated into 96-well plates coated with PDL/laminin, with 10,000 to

(13) Highly efficient and robust π-FISH rainbow for multiplexed in situ detection of diverse biomoleculesNature communicationsJanuary 27, 2023Tao Y, Zhou X, Sun L, Lin D, Cai H, Chen X, Zhou W, Yang B, Hu Z, Yu J, et al.48-well culture plate. The cells were washed with PBS and treated with 0.25% (w/v) trypsin (Gibco, 25300120). After being resuspended in the culture medium, the cells were seeded on the cover slips (poly-D-lysine

(14) Identification and functional characterization of potential oncofetal targets in human hepatocellular carcinomaSTAR ProtocolsDecember 16, 2022Mei-Mei Li, Fan-En Kong, Guang-Meng Li, Yi-Ti He, Xiao-Feng Zhang, Cheng-Yang Zhang, Jie-Kai Liang, Xin-Yuan Guan, Ning-Fang Ma, Mao-Bin Xie, et al.,AAT Bioquest,4501 TrypLE Express,Thermo Fisher Scientific,12605028 Trypsin-EDTA (0.05%),Thermo Fisher Scientific,25300120 TO type biological tablet transparent agent (TO),Beijing Solarbio Science & Technology,CB44716046 Wnt-3a,R&D

(15) Shenlian extract attenuates myocardial ischaemia-reperfusion injury via inhibiting M1 macrophage polarization by silencing miR-155Pharm BiolDecember 1, 2022Song M, Cui X, Zhang J, Li Y, Li J, Zang Y, Li Q, Yang Q, Chen Y, Cai W, et al.CT01) were bought from Sigma. Foetal bovine serum (Cat. No: 10099141) and 0.25% Trypsin EDTA (Cat. No: 25300120) were obtained from Gibco. RIPA buffer (Cat. No: R0010) was purchased from Solarbio. Phosphatase inhibitor

(16) Label-free imaging and biomarker analysis of exosomes with plasmonic scattering microscopy†Chemical ScienceNovember 9, 2022Pengfei Zhang, Jiapei Jiang, Xinyu Zhou, Jayeeta Kolay, Rui Wang, Zijian Wan, Shaopeng WangATCC (Manassas, VA, US). Fetal bovine serum (FBS, cat. no. 10437036), trypsin–EDTA (0.05%, cat. no. 25300120), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, catalog no. 22980), and sulfo-NHS (N-hydroxysulfosuccinimide

(17) Epigenetic remodeling by vitamin C potentiates plasma cell differentiationeLifeSeptember 7, 2022Heng-Yi Chen, Ana Almonte-Loya, Fang-Yun Lay, Michael Hsu, Eric Johnson, EdahÃ GonzÃ¡lez-Avalos, Jieyun Yin, Richard S Bruno, Qin Ma, Hazem E Ghoneim, et al.19131,0.5 mg/mL "Peptide, recombinant protein","Trypsin-EDTA (0.05%), phenol red",Thermo Fisher,Cat# 25300120, Sequence-based reagent,CpG 1080 (phosphorothioate backbone),TriLink,N/A,1 µg/mL; TGACTGTGAACGTTCGAGATGA Sequence-based

(18) Multifaceted role of RNA editing in promoting loss-of-function of PODXL in canceriScienceAugust 19, 2022Ting Fu, Tracey W. Chan, Jae Hoon Bahn, Tae-Hyung Kim, Amy C. Rowat, Xinshu Xiao26140079 Antibiotic-Antimycotic (100X),Gibco,Cat# 15240062 "Trypsin-EDTA (0.05%), phenol red",Gibco,Cat# 25300120 "DPBS, no calcium, no magnesium",Gibco,Cat# 14190144 Puromycin Dihydrochloride,Fisher BioReagents,Cat#

(19) PCGF6 controls neuroectoderm specification of human pluripotent stem cells by activating SOX2 expressionNature communicationsAugust 6, 2022Lan X, Ding S, Zhang T, Yi Y, Li C, Jin W, Chen J, Liang K, Wang H, Jiang W.Cat#10378016) at 37 °C with 5% CO2 in cell incubator. These cells were passaged by 0.05% trypsin (Gibco, Cat#25300120) at 90–100% cell confluence. Generation of knockout cell lines The pair gRNAs were designed on the

(20) Immunogenicity and reactogenicity of heterologous immunization against SARS CoV-2 using Sputnik V, ChAdOx1-S, BBIBP-CorV, Ad5-nCoV, and mRNA-1273Cell Reports MedicineAugust 3, 2022Carla A. Pascuale, Augusto Varese, Diego S. Ojeda, Marina E. Pasinovich, Laura Lopez, Andres H. Rossi, Pamela E. Rodriguez, Esteban A. Miglietta, Laboratorio SeVa Group, Ignacio Mazzitelli, et al."DPBS powder, no calcium, no magnesium, 10x1L",Thermo Fisher,21600010 "Trypsin, 0.05% (1X) with EDTA 4Na, liquid",Thermo Fisher,25300120 "Penicillin-Streptomycin (10,000 U/mL)",Thermo Fisher,15140122 Paraformaldehyde,Sigma Aldrich,158127 ,, Critical

Be the First to Write a Review!

Mapping Networks of Protein- Mediated Physical Interactions Between Chromatin Elements
January 01, 2010

Trypsin-EDTA (0.05%), phenol red from Thermo Fisher Scientific

Description

Thermo Fisher Scientific

Citations (60)

Reviews

Protocols

Mapping Networks of Protein- Mediated Physical Interactions Between Chromatin Elements

Trypsin-EDTA (0.05%), phenol red from Thermo Fisher Scientific

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map