Housekeeping Genes: Universal Positive
Controls in siRNA Knockdown Experiments
|
 |
RNA interference is a powerful technique for gene
knockdown experiments in academic research and an
important tool for target identification and target validation
in therapeutic research.
|
A growing number of different cell lines are used for
gene knockdown experiments, and in many cases protocols
for transfection do not exist. In order to optimize
transfection conditions for a new cell line being investigated,
luciferase-expressing plasmids are often cotransfected
with the siRNA. However, the transfection conditions
for plasmids and siRNA are quite different, as the
plasmids must enter the nucleus, whereas siRNAs act in
the cytoplasm — therefore, these optimizations may lead
to poor results. In addition, the use of fluorescently
labeled siRNAs can give unpredictable results due to
hydrophobic effects of fluorophore groups.
|
We have successfully used housekeeping genes as universal
positive control genes for knockdown experiments
in two different cell lines. The mRNA levels were
analyzed using the LightCycler Instrument and were
quantified relative to other housekeeping genes using
the LightCycler h-Housekeeping Gene Sets.
|
Materials and Methods
|
Cell culture
|
Cells of the human adherent cell line PC3 were cultured
in RPMI 1640 medium containing 10% (v/v) fetal calf
serum and 2mM L-glutamine. Cells of the human adherent
cell line HCT116 were cultured in McCoy’s 5A medium
containing 10% (v/v) fetal calf serum and 2 mM
L-glutamine.
|
Two days prior to transfection with siRNA oligonucleotides,
5x104 cells were plated in each well of 24-
well plates. The siRNA (Dharmacon) was mixed with
diluted transfection reagent as illustrated in Figures 1
and 3. The complexes were then applied to the cells in a
100 nM siRNA concentration in medium without serum (Opti-MEM), according to the manufacturer’s instructions.
After four hours of transfection, fetal calf serum
was added to 10% (v/v) final concentration.
|
|
Isolation of mRNA, synthesis of cDNA, and
quantitative real-time PCR
|
The mRNA isolation was performed using the MagNA
Pure LC Instrument. For cDNA synthesis, the 1st Strand
cDNA Synthesis Kit was used, and quantitative real-time
PCR was performed using the LightCycler FastStart DNA Master Hybridization Probes Kit as described in the
preceding article (see pages 4–6).
|
Results
|
siRNA specific for the housekeeping gene hypoxanthine
phosphoribosyl transferase (HPRT siRNA, sense
sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense
sequence 5′CCAGUUUCACUAAUGACACAA) was used
for a knockdown in PC3 cells. The mRNA was isolated
72 hours after transfection, transcribed into cDNA and
analyzed using the LightCycler Instrument (Figure 1).
Even when varying numbers of cells were used for
mRNA purification (as can be seen in the differences in
the crossing-point [CP] values of the housekeeping gene 5-aminolevulinate synthase) the knockdown can
still be calculated by normalization to this gene.
|
|
A shift in the CP values of 2.77 was observed for the
HPRT siRNA compared with the control luciferase
siRNA. The knockdown efficiency was 85% (Figure 2).
Cytotoxic side effects of the transfection ranging from
30% to 43% were detected using the Cell Proliferation
Reagent WST-1 (compared with the control without transfection).
|
|
siRNA specific for the housekeeping gene glucose-6-
phosphate dehydrogenase (G6PDH siRNA, sense
sequence 5′AACUCCUAUGUGGCUGGCCAGUU, antisense
sequence 5′CUGGCCAGCCACAUAGGAGUUUU)
was used for a knockdown in HCT116 cells. The mRNA
was isolated 72 hours after transfection, transcribed into
cDNA and analyzed using the LightCycler Instrument
(Figure 3). Different transfection reagents and concentrations
were applied in transfection (Figure 4). The
transfection reagent R4 (currently in developement at
Roche Applied Science) was the most suitable for efficient
gene knockdown with low cytotoxicity.
|
|
Conclusion
|
The housekeeping genes G6PDH and HPRT can be used
as a positive control for gene knockdown experiments
when siRNA transfection conditions have to be optimized.
The LightCycler Instrument allows measurement
of mRNA levels relative to the mRNA levels of housekeeping
genes available in the LightCycler h-Housekeeping
Gene Sets.
|