advertisement
Advertisement (image not found)

Constructing Directional CDNA Libraries From Limited Amounts Of RNA


Generate cDNA libraries with as little as 50 ng of RNA

Constructing Directional cDNA Libraries from Limited Amounts of RNA

Barry R. Neiditch • Cherie Dewar • Tanya Hosfield • Marie Callahan
John C. Bauer • Mike Kobrin • Quinn Lu • Dianne Eckhardt
Stratagene

Melanie Lenhart • Paul Young
Human Genome Sciences, Rockville, Maryland

Stratagene has developed the PCR Library Construction Kit, which introduces a new method to generate high-efficiency cDNA libraries in a plasmid vector. Use this kit with either enriched poly(A) + RNA or as little as 50 ng of total RNA (starting material); this minuscule amount compares well with the 5 to 10 µg of RNA required when using conventional methods. The kit is based on an approach that combines linker-mediated polymerase chain reaction (PCR) for amplifying cDNA and ligation-independent cloning (LIC) for cloning PCR products. We used the kit to create an ovarian cancer cDNA library from tissue isolated by laser-capture microdissection. To evaluate our PCR methodology, we compared HepG2 libraries constructed using both traditional lambda techniques and our PCR method. Although a shift occurred in the average insert size, sequence analysis revealed that the distribution of gene classes was comparable between both libraries. Moreover, sequencing confirmed that in the PCR-generated library, no gene was over represented due to artifacts; hence, our technique is ideal for generating libraries when starting with a limited amount of material.

While cDNA libraries have become standard tools for gene discovery and characterization, conventional libraries suffer limitations. In order to achieve libraries of significant complexity, relatively large amounts of poly (A)+ RNA (5 to 10 µg) are required. To bypass this requirement, attempts have been made to apply PCR technology to the synthesis of libraries from small cell populations. Unfortunately, these attempts resulted in libraries that are nondirectional, require restriction digestion for cloning, and tend to contain small inserts.

Stratagene’s new PCR Library Construction Kit can use as little as 50 ng of total RNA as starting material to construct directional libraries in plasmid vectors. The method featured in this kit combines PCR for amplifying cDNA synthesized from small amounts of RNA with LIC for high-efficiency, directional cloning.

The kit’s double-stranded cDNAs are synthesized, then ligated to an adaptor that contains a sequence for LIC. The adaptor-ligated cDNA is amplified by PCR using primers with specifically designed LIC ends.1-3 The PCR products are ready for purification and directional cloning into a vector with compatible LIC overhangs. The kit offers numerous advantages over other cloning methods: Pfu DNA polymerase, which ensures the highest possible fidelity of the amplification process, can be used to amplify cDNA inserts. Because cloning of PCR products is directional, libraries generated using this method can be used for high-throughput 3¢ EST sequencing and for functional screening. Additionally, this method does not depend on the use of T4 DNA ligase to covalently link the vector and insert; consequently, the background of self-ligated vector is reduced. Since PCR products are cloned without endonuclease reactions, cleavage of inserts at internal restriction sites is avoided.

On another exciting front, the kit can be used to make cDNA libraries from tissue samples isolated by laser-capture microdissection (LCM).4 This technique, developed at the National Institutes of Health, captures pure populations of targeted cells from microscopic samples of tissue samples for transfer to a polymer film. Specific cells are isolated within their own milieu, thus securing the complex biochemical and physical effects exerted by the surrounding environment. Cells isolated by LCM are ideal for use in a variety of applications, such as analyzing the patterns of gene expression in normal, healing, developing, and differentiating cells. Stratagene, in collaboration with the Cancer Genome Anatomy Project (CGAP) of the National Cancer Institute (NCI), developed the kit to fulfill NCI’s goal of identifying the molecular signature of a cancer cell.

Construction of cDNA Libraries

cDNA2

Fig.2

First-strand cDNA synthesis is primed from as little as 50 ng of total RNA using the LIC-R-linker/primer (Figure 2), which contains an oligo(dT) sequence and a specific LIC-Right sequence. After standard second-strand synthesis, a double-stranded adaptor, the LIC-L-adaptor, which encodes the EcoR I cohesive end and an LIC(L) sequence, is ligated to the double-stranded cDNA ends. The adaptor-ligated cDNA is then used as a template for PCR amplification using the LIC-Left and LIC-Right PCR primers. PCR products are purified to remove nucleotides and primers and are treated with Pfu DNA polymerase in the presence of dATP. In the absence of dTTP, dGTP, and dCTP, the 3¢- to 5¢-exonuclease activity of Pfu DNA polymerase removes at least 12 or 13 nucleotides at the 3¢ ends of the PCR product, thus creating LIC-compatible overhangs.5 These LIC-ready cDNA inserts are annealed to the LIC-ready pCMV-PCR® vector and transformed into Epicurian Coli® XL10-Gold® Camr ultracompetent cells.*

The PCR Library Construction Kit comprises three modules: a cDNA synthesis module,§ an amplification module, and a pCMV-PCR vector module.§ Together the modules provide the necessary reagents for cDNA synthesis, including the LIC-R-linker/primer and LIC-L-adaptor, purification-column components, LIC-Left and LIC-Right PCR primers, PCR reagents, the LIC-ready pCMV-PCR vector, and XL10-Gold ultracompetent cells.

The pCMV-PCR® Vector

Stratagene designed the pCMV-PCR mammalian expression vector to be used with the PCR Library Construction Kit. The pCMV-PCR vector (Figure 1) is derived from the pCMV-Script® vector 6 and features the LIC site. The pCMV-PCR vector shares many attributes of its parental pCMV-Script vector, such as the cytomegalovirus (CMV) promoter### for constitutive expression in a wide variety of cell lines. It also includes the neomycin-phosphotransferase gene under dual control of the ß-lactamase and SV40 promoters, which provides selection by kanamycin resistance in bacteria and G418 resistance in mammalian cells. The multiple cloning site (MCS) of the pCMV-PCR vector is flanked by T3 and T7 promoters, which allow generation of RNA by in vitro transcription of a DNA insert in either orientation.

cDNA1

Fig.1

Ovarian Tumor Library

An ovarian tumor library was made from approximately 100 ng of total RNA derived from LCM tissue. cDNA was synthesized and amplified by PCR with LIC-specific primers. The PCR products were purified, prepared for LIC, annealed to the LIC-ready pCMV-PCR vector, and transformed into XL10-Gold cells. The cloning efficiency was approximately 2.0 x 105 colony-forming units (cfu)/µg of PCR-amplified cDNA. We examined this library by PCR analysis of 20 randomly picked colonies to determine the background levels and the distribution of insert size. The clones examined contained an average insert size of 700 base pairs (Figure 3). Sequence analysis confirmed that inserts contained 3¢-polyadenlylation regions (data not shown).

cDNA3

Fig.3

With the kit, we successfully generated other cDNA libraries as well. These libraries were constructed from 50 to 100 ng of total RNA from human macrophage cells, human prostate cells, and several cancerous tissues derived from LCM. All libraries contained a low percentage of nonrecombinants, and inserts were confirmed to contain polyadenlylation sequences.

Sequence Analysis and Comparison of HepG2 Libraries

We compared the sequence analysis of two HepG2 libraries: A HepG2 Lambda ZAP® II library was constructed starting with 5 µg of poly (A)+ RNA using traditional methods, and a second HepG2 library was created with 100 ng of total RNA using the PCR-based method previously described. In each case, over 1000 clones were analyzed, then the clones were characterized into several classes (Table 1). The average insert size shifted from 2.1 kb in the lambda library to 0.8 kb in the PCR library. In Table 1, the breakdown of analyzed sequences into gene classes is described for each library, and the known genes identified for both libraries coordinate with the expected sequences that we observed to be expressed in liver tissue.

 

Class 1: Sequence is identical to a known human gene
Class 2: Sequence has a significant match with a human protein
Class 3: Sequence has a significant match to a nonhuman protein
Class 4: Mitochondrial and vector sequence
Class 5: Unknown genes. Sequence has no significant match in the public database

Library Name

Class 1

Class 2

Class 3

Class 4

Class 5

HepG2 Lambda Library

61%

4%

8%

12%

15%

HepG2 PCR library

48%

1%

7%

19%

15%

Conclusions

Stratagene’s new PCR Library Construction Kit allows efficient and directional cloning of cDNA inserts into the pCMV-PCR vector. The kit is complete and can be used to generate libraries from purified mRNA as well as limited amounts of total RNA. It is particularly useful in situations where samples are difficult to obtain, such as LCM, early development stages, and any specially isolated cell population. The kit combines PCR technology for amplifying cDNA with the LIC technique for cloning PCR products: we successfully constructed numerous libraries, including an ovarian tumor library from human LCM tissue. The library inserts were confirmed by PCR and sequence analysis. The HepG2 library comparison clearly shows that no artifacts are introduced due to the PCR-based method (i.e., no particular gene is over represented), and that the PCR-generated method is an efficient way to obtain a library with significant complexity that is representative of the starting material.

Materials and Methods PCR Conditions:

An ovarian tumor library was constructed using 100 ng of RNA from LCM-derived tissue. Ovarian cDNA library inserts were PCR amplified in 100-µl reactions in 0.75-ml, thin-walled PCR tubes; reaction components were as specified in the kit’s manual. These reactions were amplified using the RoboCycler® 96 temperature cycler and the following cycling conditions: 1 cycle of 93ºC for 5 minutes, 55ºC for 5 minutes, 72ºC for 4 minutes; 28 cycles of 93ºC for 1 minute, 55ºC for 1 minute, and 72ºC for 4 minutes; 1 cycle of 72ºC for 10 minutes.

Primer Sequences:

LIC-R-linker/primer: 5¢-(GA)6CTCGAGGAACAAGACCCGTTACTAGTAC(T)18-3¢
LIC-Right PCR primer: 5¢-GGAACAAGACCCGTTACTAGTACTT-3¢
LIC-Left PCR primer: 5¢-GACGACGACAAGTTAACGTCG-3¢

Acknowledgments

We thank Robert Buchner, Tim Sanchez, Jeff Mueller, Jeff Braman, and members of both the Genetic Systems Group and the Custom Library Group at Stratagene for suggestions and discussions.

REFERENCES

  1. Aslanidis, C. and de Jong, P.J. (1990) Nuc. Acids Res. 18: 6069-6074.

  2. Huan, R.S., Serventi, I.M., and Moss, J. (1992)  BioTechniques 13: 515-518.

  3. Huan, R. and Moss, J. (1992) Gene 112: 37-43.

  4. Bonner, R.F., et al. (1997) Science 278: 1481-1483.

  5. Wyborski, D.L., et al. (1997) Strategies 10: 15-18.

  6. Hosfield, T., et al. (1997) Strategies 10: 68-69.


* U. S. Patent Nos. 5,512,468 and 5,707,841 and patents pending

Stratagene Contact Information

Stratagene
11011 North Torrey Pines Road
La Jolla, CA 92037 USA

Customer Service: (800) 424-5444

Tech Support: 800-894-1304

Fax Number: (512) 321-3128

Web Site: http://www.stratagene.com
Article Tools
advertisement

You do not have JavaScript enabled or are using an older version of Adobe Flash. You can update your version of Adobe Flash here.

Email Newsletter Sign-Up

Stay updated on the latest technologies and news with Biocompare's newsletters
(See samples here)












Select All

Loading

Loading