Eppendorf MixMate – Experimental evidence
of controlled mixing,using a PCR-based
chessboard assay
Caroline Osterhoff1, Philip Müller2 and Lars Borrmann1
1Eppendorf AG, Hamburg, Deutschland; 2Eppendorf Instrumente GmbH, Hamburg, Germany
Abstract
The Eppendorf MixMate was developed to enable small volumes of 5 μl - 2 ml to be mixed quickly and under
controlled conditions in micro plates or micro test tubes. The results of the chessboard assay performed
herein prove that even at high mixing speeds and long mixing time, there is no cross-contamination between
the wells of a PCR plate when this is mixed on MixMate without the wells being sealed. The innovative
2DMix-Control technology of MixMate accordingly improves reproducibility of experimental conditions and
saves time by eliminating unnecessary centrifugation steps after mixing.
Introduction
The cutting-edge progress of technological
development over recent years has led to laboratories
working with smaller and smaller volumes. Whereas
yesterday they were still using 0.5 ml PCR tubes, now
they are using 96- or 384-well PCR plates. Whereas
only a few years ago, 10 ml tubes were still being used
for bacterial cultures, now deepwell plates are the norm.
However, these new formats and their special
geometries, together with the smaller and smaller
reaction volumes involved, do place very specific
demands on efficient mixing that conventional mixers
cannot fully satisfy (1). Recent experiments have shown
that mixing speed is not the sole criterion for efficient
mixing of small volumes in small tubes. It is far more the
case that the perfect mixing process demands
optimized interaction of parameters such as speed, type
of mixing movement (e.g., orbital), mixing radius and
smooth running.
This latest information about mixing small volumes was
taken into account in developing the Eppendorf
MixMate. The term "2DMix-Control" (Figure 1) covers all
the properties of the MixMate that contribute to rapid
and controlled mixing of even the smallest volumes. The
optimized properties of the MixMate act on the three
categories described below.
- Generating adequate mixing energy: MixMate's orbital
mixing movement at a high mixing speed
(max. 3,000 rpm) and a relatively large mixing radius
(1.5 mm) generates enough mixing energy (analogous
to g-force in centrifuges) to mix even the smallest
volumes efficiently.
- Minimized loss of mixing energy: During MixMates's
development, special attention was paid to reducing
inherent vibration. Its smooth operation combined
with its reliable stability ensures that all the mixing
energy is available for mixing and not wasted through
transmission of vibrations to the device or its
surroundings.
- Controlled transmission of energy from the device
to the sample: Minimizing vertical movements enable
a plane, 2-dimensional (2D) mixing stroke. This, in
conjunction with the reliable plate holder, prevents
uncontrolled chaotic motion of liquid and ensures a
secure fit of all formats even at high mixing frequency.
MixMate's planar mixing without vertical movement,
extreme running smoothness and great sturdiness
allows it to control the movement of the liquid inside the
tubes. This controlled mixing movement (anti-spill
technology) prevents spilling or lid wetting in standard
laboratory applications, thereby eliminating timeconsuming
centrifugation steps after mixing, as well as
preventing cross-contamination between individual
wells.
The experiments described in this Application Note are
intended to provide experimental evidence of controlled
mixing. In order to prove that mixing with the MixMate
does not lead to cross-contamination between different
wells in a PCR plate, a so-called chessboard assay (2)
was performed. To this end, template DNA or H2O as a
negative control were added to alternate 50 μl PCR
preparations in a 96-well PCR plate. The PCR plate was
then mixed for 10 min in the MixMate without the wells
being sealed at the recommended mixing speed of
1,650 rpm (settings correspond to the MixMate's
preprogrammed soft key for 96-well PCR plates: PCR
96/0.5). Subsequent to the PCR, PCR products were
detected in agarose gels to allow potential
cross-contamination to be detected.
Material and methods
"Chessboard assay" PCR setup
50 μl hot start PCR
reaction preparations for amplifying a 535 bp fragment
of the human β globin gene (HBB), consisting of
Eppendorf HotMasterMix and in each case 0.2 μM
primer (sense: GGTTGGCCAATCTACTCCCAGG;
antisense: GCTCACTCAGTGTGGCAAAG), were
pipetted into Eppendorf twin.tec PCR Plates 96. To
detect potential cross-contamination, either genomic
DNA (final concentration 1 ng/μl, Roche, Penzberg,
Germany) or H2O as a negative control were pipetted
into alternate wells as shown in Figure 2.
Mixing the PCR preparations
To provide evidence that
the MixMate can mix the samples under controlled
conditions and without wetting the lids, the readypipetted
chessboard assay was mixed without sealing
(i.e., with open wells) for 10 min at 1,650 rpm (soft key
PCR 96/0.5). The plates for amplification were then
subsequently sealed with self-adhesive PCR film
(Eppendorf).
PCR amplification and detection
PCR amplification
was performed in a Mastercycler® ep gradient S
thermocycler* (Eppendorf) in accordance with the
following temperature profile: initial denaturing for 2 min
at 94 °C, 30 cycles of 30 s at 94 °C, 30 s at 60 °C and
30 s at 65 °C.
Following addition of 6 μl 10x DNA Gel Loading Buffer
(Eppendorf) to each well, the preparations were
thoroughly mixed in the MixMate for 5 s at 1,650 rpm.
A tenth volume of the experimental preparations was
then analyzed qualitatively in a 0.9 % agarose gel using
ethidium bromide staining and DNA marker (100 bp DNA
ladder, BioCat, Heidelberg, Germany).
Results
To provide evidence of the anti-spill technology of the
Eppendorf MixMate, PCR preparations pipetted in the
pattern of a chessboard with and without template DNA
were mixed before amplification in a 96-well PCR plate
without the wells being sealed first. Although the
MixMate requires just a few seconds to mix PCR
preparations completely, the plates were mixed for
10 min at 1,650 rpm without being sealed to
demonstrate controlled mixing.
As can be clearly seen from Figure 3, there is no cross contamination
or false-positive PCR signal in the
negative controls (preparations without template DNA)
as a result of the plate being mixed without being
sealed, despite the relatively large PCR volume of 50 μl.
Experiments performed to determine the sensitivity of
the PCR system used showed that cross-contamination
with less than 0.5 μl is enough to lead to a clearly visible
PCR band (data not shown).
To further demonstrate controlled mixing, the mixing
stroke of the MixMate was photographed in time-lapse
(Figure 4). The pictures show that the sample liquid
moves orbital within the wells of the PCR plate without
uncontrolled chaotic movements.
Discussion
The data presented in this Application Note show that
the MixMate is capable of controlling the mixing
movement of liquids so as to prevent uncontrolled
splashing and consequently contamination of adjacent
wells. Compared to conventional mixers, the MixMate
has the advantage that samples no longer need
centrifuging down after mixing, saving working steps
and consequently time. Even in PCR applications, in
which PCR preparations are frequently mixed by being
aspirated and dispensed several times, it is possible to
use the MixMate to save time, reduce additional
consumption of pipette tips and avoid the risk of
contamination due to formation of aerosols when
pipetting.
The innovative 2DMix-Control technology accordingly
facilitates reproducible results, an important prerequisite
for PCR setup, resuspension of pellets, reporter gene
assays, luciferase assays and ELISA assays, for example, as well as in colorimetric quantification of
proteins.
While it is possible to control the mixing movement with
the MixMate, the risk of wet lids is, in principle, also
dependent on factors like tube geometry, mixing speed,
filling volume and the sample material used. To simplify
the setting of the ideal mixing parameters given this
large number of variables, the MixMate has five soft
keys with preprogrammed parameters that guarantee
fast and controlled mixing in standard applications in a
variety of plate and tube formats.
All in all, the option of controlled mixing and the
thorough mixing in seconds of even tricky sample
materials up to 96-well and 384-well plates (1) mean
that the Eppendorf MixMate ensures maximum
reproducibility for the experimental conditions and
saves time because centrifugation steps are no longer
required.
Literature
1. Osterhoff C, Mueller P, Borrmann L. Comparison of mixing performance in 96- and 384-well plates of Eppendorf
MixMate and competitor devices. Eppendorf Application Note 130, 2006.
2. Apostel F. Automated PCR setup in the 384-well format without cross-contamination with the Liquid Handling
Workstation epMotion 5070. Eppendorf BioNews Application Notes 2003; 20:1–2.Ordering information