Q5 High-Fidelity PCR Kit from New England Biolabs

Product Specs
ItemQ5 High-Fidelity PCR Kit
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberE0555S
Quantity50 reactions
Brand/TrademarkNew England Biolabs Inc (NEB)
ApplicationsDNA Analysis, PCR
TypeDNA Polymerase
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) PMS1 as a target for splice modulation to prevent somatic CAG repeat expansion in Huntington's diseasebioRxivJuly 30, 2023Zachariah L. McLean, Dadi Gao, Kevin Correia, Jennie C. L. Roy, Shota Shibata, Iris N. Farnum, Zoe Valdepenas-Mellor, Manasa Rapuru, Elisabetta Morini, Jayla Ruliera, et al.(Supplementary table 1) from HEK293T genomic DNA. We used the Q5® High-Fidelity PCR Kit (New England Biolabs, E0555S) with the following conditions: initial denaturation 98 °C (3 min), 35 cycles of 98 °C (10 s), 64 °C

(2) Super-resolution imaging unveils the self-replication of tau aggregates upon seedingCell reportsJuly 25, 2023Dimou E, Katsinelos T, Meisl G, Tuck BJ, Keeling S, Smith AE, Hidari E, Lam JYL, Burke M, Lövestam S, et al.Universal PCR Master Mix,Applied Biosystems,Cat# 4305719 Q5 High-Fidelity PCR Kit,New England Biolabs,Cat# E0555L Quick Ligation Kit,New England Biolabs,Cat# M2200L PureLink HiPure Plasmid Maxiprep Kit,Thermo Fisher,Cat#

(3) Covalent TCR-peptide-MHC interactions induce T cell activation and redirect T cell fate in the thymusNature CommunicationsAugust 23, 2022Christopher Szeto, Pirooz Zareie, Rushika C. Wirasinha, Justin B. Zhang, Andrea T. Nguyen, Alan Riboldi-Tunnicliffe, Nicole L. La Gruta, Stephanie Gras, Stephen R. Daleytranscripts were PCR amplified using a Q5® High-Fidelity PCR Kit (New England BioLabs, Ipswich, MA, Cat. no. E0555L) and a mix of 19 Trbv-specific forward primers and a single Trbc-specific reverse primer and TCRα transcripts

(4) Determining immunoglobulin-specific B cell receptor repertoire of murine splenocytes by next-generation sequencingSTAR ProtocolsJune 17, 2022Anja Werner, Simon SchÃ¤fer, Nina GleuÃŸner, Falk Nimmerjahn, Thomas H. Winklerextension PCR (day 3; Timing: 2 h).This step was performed using the Q5® from New England Biolabs (#E0555S) with minor adaptions to manufacturer`s instructions and i5 and i7 primers of Nextera XT Index Kit v2

(5) Toxoplasma gondii Rhoptry Protein 7 (ROP7) Interacts with NLRP3 and Promotes Inflammasome Hyperactivation in THP-1-Derived MacrophagesCellsMay 12, 2022Zhu L, Qi W, Yang G, Yang Y, Wang Y, Zheng L, Fu Y, Cheng X.Briefly, pSAG1::CAS9-U6::sgROP7 and pROP7::DHFR-D were constructed using Q5 High-Fidelity DNA Polymerase (#E0555L, NEB, Ipswich, MA, USA) and the NovoRec plus One-step PCR Cloning Kit. The plasmids (between 80-μg pSAG1::CAS9-U6::sgROP7

(6) Oncogenic RAS sensitizes cells to drug-induced replication stress via transcriptional silencing of P53OncogeneMay 6, 2022Hendrika A. Segeren, Elsbeth A. van Liere, Frank M. Riemers, Alain de Bruin, Bart Westendorpsequence using the Q5 Site-Directed Mutagenesis kit according to the manufacturers’ instructions (NEB, E0555S). The fluorescent tag of truncated 53BP1 was changed to mTurquoise2 using Gibson Assembly. Cells harboring

(7) Cholesterol determines the cytosolic entry and seeded aggregation of tauCell reportsMay 3, 2022Tuck BJ, Miller LVC, Katsinelos T, Smith AE, Wilson EL, Keeling S, Cheng S, Vaysburd MJ, Knox C, Tredgett L, et al.Universal PCR Master Mix,Applied Biosystems,Cat# 4305719 Q5 High-Fidelity PCR Kit,New England Biolabs,Cat# E0555L Quick Ligation Kit,New England Biolabs,Cat# M2200L PureLink HiPure Plasmid Maxiprep Kit,Thermo Fisher,Cat#

(8) Functional CDKN2A assay identifies frequent deleterious alleles misclassified as variants of uncertain significanceeLifeJanuary 10, 2022Hirokazu Kimura, Raymond M Paranal, Neha Nanda, Laura D Wood, James R Eshleman, Ralph H Hruban, Michael G Goggins, Alison P Klein, Nicholas J The Familial Pancreatic Cancer Genome Sequencing Project, Nicholas J The Familial Pancreatic Cancer Genome Sequencing ProjectpHAGE-CDKN2A-L78Hfs*41, respectively, using the Q5 High-Fidelity PCR kit (New England Biolabs, Ipswich, MA; catalog no. E0555S) as previously described (Zhen et al., 2017). Primers used to subclone CDKN2A and CDKN2A-L78Hfs*41 cDNAs

(9) Function and transcriptional regulation of TCTN1 in oral squamous cell carcinomaOncology ReportsDecember 1, 2021Guangliang Bai et al.pGL3-TCTN1 (−550/-491) as the template was performed, by using a Q5 high-fidelity DNA polymerase (#E0555L, New England Biolabs, Inc.) in an ABI Veriti PCR thermocycle instrument (Applied Biosystems) according

(10) CKB inhibits epithelial-mesenchymal transition and prostate cancer progression by sequestering and inhibiting AKT activationNeoplasiaNovember 1, 2021Zheng Wang et al.plasmids, PCR was performed following the manufacturer's instruction of Q5 High-Fidelity PCR Kit (#E0555S, New England Biolabs) by mixing templates and primers listed below. PCR products were purified by gel

(11) CHD1 controls H3.3 incorporation in adult brain chromatin to maintain metabolic homeostasis and normal lifespanCell ReportsOctober 5, 2021Ines Schoberleitner et al.protease inhibitor coctail",Roche,Cat#COEDTAF-RO Q5 High-Fidelity DNA Polymerase,New England Biolabs,Cat#E0555 Tegosept,Sigma Aldrich,Cat#54680 Rapamycin from Streptomyces hygroscopicus,Sigma Aldrich,Cat#R0395 Triton X-100

(12) Targeting B cells in the pre-phase of systemic autoimmunity globally interferes with autoimmune pathologyiScienceSeptember 24, 2021Anja Werner, Simon SchÃ¤fer, Olga Zaytseva, Heike Albert, Anja Lux, Jasminka KriÅ¡tiÄ‡, Marija Pezer, Gordan Lauc, Thomas Winkler, Falk NimmerjahnUracil+ ReadyMix Kit,Kapa Biosystems,Cat. # KK2801 Q5® High-Fidelity PCR Kit,New England BioLabs,Cat. # E0555L Mouse BAFF ELISA Kit,abcam,Cat. # ab119580 ,, Deposited Data,Deposited Data,Deposited Data ,, Raw

(13) An additional NF-κB site allows HIV-1 subtype C to evade restriction by nuclear PYHIN proteinsCell ReportsSeptember 21, 2021Matteo Bosso et al.Activated Cell P3 Lonza Kit,Lonza,Cat# V4XP-3024 Q5® High-Fidelity PCR Kit,New England Biolabs,Cat# E0555S Phusion High-Fidelity PCR Kit,ThermoFisher,Cat# F553L DNA Ligation Kit Ver. 2.1,TaKaRa,Cat# 6022 GalScreen,Applied

(14) Fluorescent tagging of endogenous proteins with CRISPR/Cas9 in primary mouse neural stem cellsSTAR ProtocolsSeptember 17, 2021Christopher S. Morrow, Tiaira J. Porter, Darcie L. Moorehigh-fidelity polymerases can be used instead of Phusion, such as Q5 High-Fidelity DNA Polymerase (NEB E0555S).b.Following completion of the reaction, gel purify (Qiagen 28704) each DNA fragment.21.Restriction digest

(15) Protocol for using fluorescent sensors targeted to endogenous proteins (FluoSTEPs) to measure microdomain-specific signaling eventsSTAR ProtocolsSeptember 1, 2021Jason Z. Zhang, Brian Tenner, Sohum Mehta, Jin ZhangVector,Invitrogen,Cat# K450002 DNeasy Blood and Tissue Kit,QIAGEN,Cat# 69504 Q5 High-Fidelity PCR Kit,NEB,Cat #E0555S PureLink Quick Gel Extraction Kit,Thermo Fisher,Cat# K220001 35-mm Glass bottom imaging dish,Cellvis,Cat#

(16) Large-Fragment Deletions Induced by Cas9 Cleavage while Not in the BEs SystemMolecular Therapy - Nucleic AcidsSeptember 4, 2020Yuning Song, Zhiquan Liu, Yuxin Zhang, Mao Chen, Tingting Sui, Liangxue Lai, Zhanjun Liextracted from mutation and control rabbits. The DNA was amplified with Q5 high-fidelity 2× master mix (#E0555L, NEB, USA). Primers for large-fragment mutation detection were designed using Primer3-BLAST (Table S1).

(17) The biochemical basis for the cooperative action of microRNAsProceedings of the National Academy of SciencesJuly 28, 2020Daniel Briskin, Peter Y. Wang, David P. Bartelappropriate primers (SI Appendix, Table S1) (Q5 High-Fidelity DNA Polymerase; New England BioLabs; E0555S) and then inserted into the pMAL-c5X vector (New England BioLabs; N8108S) using Gibson assembly per

(18) AcrIIA5 Suppresses Base Editors and Reduces Their Off-Target EffectsCellsJuly 27, 2020Mingming Liang, Tingting Sui, Zhiquan Liu, Mao Chen, Hongmei Liu, Huanhuan Shan, Liangxue Lai, Zhanjun LiGenome Editing Frequency All on-target sites were amplified using a Q5 High-Fidelity PCR Kit (NEB #E0555S) and then subjected to Sanger sequencing. All primers used for base-editing analysis are listed in Table

(19) Germline CRISPR/Cas9-Mediated Gene Editing Prevents Vision Loss in a Novel Mouse Model of AniridiaMolecular therapy. Methods & clinical developmentJune 12, 2020Mirjalili Mohanna SZ, Hickmott JW, Lam SL, Chiu NY, Lengyell TC, Tam BM, Moritz OL, Simpson EM.Site-Specific NGS The region around Sey mutation was PCR amplified using a Q5 high-fidelity PCR kit (E0555S; New England Biolabs), with primer pair oEMS6299 (5′-ATGCCGTTCCGATTTCTC-3′) and oEMS6171 (5′-GCTGTGGCATTTCCTTTG-3′).

(20) SRF-FOXO1 and SRF-NCOA1 Fusion Genes Delineate a Distinctive Subset of Well-differentiated RhabdomyosarcomaAmerican Journal of Surgical PathologyMay 1, 2020Marie Karanian et al.ThermoFisher Scientific, Courtaboeuf, France) on 1µg of RNA prior to PCR amplification (Q5-high Fidelity-PCR kit #E0555S, New England Biolabs, Evry, France) using the following primers: 5’AGTGCAGGCCATTCAAGT3’ (SRF exon 4, forward) and 5’GTGAGCTAATACACTGGTCTTCT3’

Be the First to Write a Review!