Fig 2: Q–PCR analysis detects transcription in pre-blastoderm embryos.(A) RNA extracted from wildtype embryos at the indicated cycles, from unfertilized eggs (0) and from Df(en) cycle 14 – germ band extended embryos (GBE) was used to template PCR using primers that nestle en intron 1 (see Table S1). No product was detected after 40 PCR cycles using RNA extracted from unfertilized eggs or from Df(en) cycle 10–12 embryos. Product using primers for actin transcripts was detected in all samples. (B) cDNAs prepared from RNA extracted from wildtype embryos at the indicated nuclear cycles was used to template PCR using primers that nestle an intron of en, h, odd, Kr, and eve. Amount of RNA used to prepare the cDNA templates for PCR amplification: (A) 30 ng for nuclear cycles 0–9; 5 ng for nuclear cycles 9–14 and GBE; (B) 30 ng for nuclear cycles 3–6 and 8. PCR reactions were performed in an ABI 3730 Thermocycler for (A) and a BioRad C1000 Touch Thermal Cycler for (B); the number of PCR cycles required to amplify en transcripts differed with the two instruments (presumably due to distinct cycling protocols), but was reproducible for each instrument.

Fig 3: Overview of the DRUG-seq protocol. (A) Once cells are plated and treated with perturbagens, the DRUG-seq protocol can be performed and sequenced in 5 days. The process and equipment depicted here is for batches of 18 or fewer plates. Scale up or down is possible depending upon infrastructure available. Echo 555 image—©2022 Beckman Coulter, Inc. Used with permission. Bravo image—©Agilent Technologies, Inc. Reproduced with Permission, Courtesy of Agilent Technologies, Inc. C1000 touch image—Courtesy of Bio-Rad Laboratories, Inc., © 2022. ViiA 7 image—ThermoFisher Scientific Inc. HiSeq. 4000 image—Used under license from Illumina, Inc. All Rights Reserved. (B) Depiction of the DRUG-seq high-throughput RNA-seq chemistry (adapted from Ye et al., 2018). Day 1: the scale of DRUG-seq is enabled using a direct in-well lysis of cells without mRNA purification, which is coupled to a barcoding and sequencing strategy that tracks transcripts (UMI), wells (well barcode) on day 2. On day 3, library construction incorporates plate barcodes and generates cDNA libraries (illumina Nextera or custom Illumina indexes) to be quantified and sequenced on the illumina platform (days 4–5).

Fig 4: Survival impact of ABCA3 expression in AML. Kaplan-Meier curves of LFS in the pediatric exploratory set (A), pediatric validation set (B), pediatric entire dataset (C), and adult entire set (D) as well as restricted to patients treated with chemotherapy only (E) or GO) (F). No at risk, number of patients at risk. Patients with high (red curves) and low (blue curves) ABCA3 expression were separated with the best determined cutoff value of 1.20 AU. Hazard ratios (HR) were computed with 95% confidence intervals (95CI), log-rank P values set on the graphs. Quantitative RT-PCR analysis was carried out with iQ SYBR Green Supermix (Bio-Rad) according to the manufacturer’s instructions using oligonucleotides against exon 6 and 7 of ABCA3 (annotated according to FasterDB database (ABCA3_F: CCTTCAACCACAGCAAGGAG, ABCA3_R: TTGGGAAAAGCGGGAAAAGG). Relative quantification of the E6-E7 fragment of ABCA3 transcripts was performed according to the method described by Pfaffl using GUSb and ABL1 as references (GUSb_F: GCCTGGGTTTTGTGGTCATCTATTC, GUSb_R: CAGTAGCCACTTTCATGCCAACTC, ABL1_F: TGGTAGGGGAGAACCACTTG, and ABL1_R: GGTAGCAATTTCCCAAAGCA). Cycling reactions were performed with a C1000 Touch Thermal Cycler (Bio-Rad) and fluorescence signals measured with a CFX96 Real-Time System (Bio-Rad). Data were processed with CFX Manager software version 3.1 (Bio-Rad). RT-qPCR data were expressed in arbitrary units (AU).

Fig 5: A representative experiment to test the efficiencies of PCR systems selected in this work by the serial dilution method. (4-fold dilution series). The most concentrated sample corresponded to 10-fold-diluted cDNA synthesized from 1 µg of rat temporal cortex total RNA. PCR reactions were triplicated and carried out in a C1000 Touch thermal cycler combined with a CFX384 Touch Real-Time PCR Detection System (BioRad, Hercules, CA, USA) simultaneously with no template control samples. The colors of the amplification curves indicate the detection channel (blue for FAM (Grm4, Grm2, Grm1), green for HEX (Grm5, Grm7), orange for ROX (Grm3, Grm8)).