SignalSilence ® beta-Arrestin 1 siRNA I from Cell Signaling Technology

Product Specs
ItemSignalSilence ® beta-Arrestin 1 siRNA I
CompanyCell Signaling Technology
Price Pricing Info Supplier Page View Company Product Page
Catalog Number6218S
Quantity300 µl
TargetArrestin, beta1
NCBI Gene AliasesARB1, ARR1
NCBI Full Gene Namearrestin beta 1
Research AreaMAP Kinase Signaling
ReactivityH
ApplicationssiRNA
TypesiRNA

Add to Compare List

Cell Signaling Technology

3 Trask Lane

Danvers, Massachusetts 01923

United States

Phone: 877-616-CELL
Phone: 978-867-2388
Fax: 866-432-6112
Fax: 978-867-2488

Company Profile

Website: http://www.cellsignal.com/

Website: Technical Support

(1) Nanoparticle Components and Numberâ€“Size Distribution of Waste Cooking Oil-Based Biodiesel Exhaust Gas from a Diesel Particulate Filter-Equipped EngineACS OmegaFebruary 1, 2022Mongkol Dangsunthonchai, Poranat Visuwan, Cholada Komintarachat, Kampanart Theinnoi, Sathaporn Chuepengwas connected to the engine accompanied by a data acquisition system (National Instruments, model USB-6218) to log for local temperature and pressure based on the LabVIEW code. A balance (CST, model CDR-3) and

(2) PACAP–PAC1 Signaling Regulates Serotonin 2A Receptor InternalizationFront Endocrinol (Lausanne)October 25, 2021Atsuko Hayata-Takano, Yusuke Shintani, Keita Moriguchi, Naoki Encho, Kohei Kitagawa, Takanobu Nakazawa, Hitoshi Hashimotosilencing of β-arrestins was performed exactly as described in our previous study (4). β-arrestin1 (6218S; Cell Signaling Technology, Danvers, MA, USA), β-arrestin2 (sc-29743; Santa Cruz Biotechnology, Dallas,

(3) Genetic and Functional Dissection of the Role of Individual 5-HT₂ Receptors as Entry Receptors for JC PolyomavirusCell reportsMay 14, 2019Assetta B, Morris-Love J, Gee GV, Atkinson AL, O'Hara BA, Maginnis MS, Haley SA, Atwood WJ.siRNA and control siRNA were obtained from Cell Signaling Technologies (SignalSilenceβ-arrestin1 siRNA #6218 and SignalSilence Control siRNA (unconjugated #6568) and were used at a concentration of 100 nM. Following

(4) JC Polyomavirus Entry by Clathrin-Mediated Endocytosis Is Driven by β-ArrestinJournal of virologyApril 15, 2019Mayberry CL, Soucy AN, Lajoie CR, DuShane JK, Maginnis MS.s475 Ambion, DNM1L, s19559 Ambion, DNM2, s4212 Cell Signaling, SignalSilence beta-arrestin 1 siRNA I, 6218s Dharmacon, AP2M2, custom/AAGUGGAUGCCUUUCGGGCAUU Ambion, AP2B2, s36 Cell Signaling, SignalSilence EGF receptor siRNA II

(5) β-Arrestin1 and 2 differentially regulate PACAP-induced PAC1 receptor signaling and traffickingPLOS ONEMay 7, 2018Yusuke Shintani, Atsuko Hayata-Takano, Keita Moriguchi, Takanobu Nakazawa, Yukio Ago, Atsushi Kasai, Kaoru Seiriki, Norihito Shintani, Hitoshi Hashimotoin a blind manner. β-arrestin silencing For siRNA-induced silencing of β-arrestins, β-arrestin1 (#6218S; Cell Signaling Technology, Danvers, MA, USA), β-arrestin2 (#sc-29743; Santa Cruz Biotechnology, Dallas,

(6) A calcium-sensing receptor mutation causing hypocalcemia disrupts a transmembrane salt bridge to activate β-arrestin-biased signalingScience signalingFebruary 20, 2018Gorvin CM, Babinsky VN, Malinauskas T, Nissen PH, Schou AJ, Hanyaloglu AC, Siebold C, Jones EY, Hannan FM, Thakker RV.48 hours before experiments, as described (49). Single siRNAs targeted to β-arrestin1 (Catalog No: 6218S, Cell Signalling Technology) or β-arrestin2 (Catalog No: sc29208, SantaCruz Biotechnology), or scrambled

(7) BioID identifies proteins involved in the cell biology of caveolaePloS oneJanuary 1, 2018Mendoza-Topaz C, Yeow I, Riento K, Nichols BJ.

(8) Tissue and time specific expression pattern of interferon regulated genes in the chickenBMC GenomicsMarch 28, 2017Susanne Röll, Stefan Härtle, Thomas Lütteke, Bernd Kaspers, Sonja Härtle

Be the First to Write a Review!