damMethyltransferase from New England Biolabs

Product Specs
ItemdamMethyltransferase
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberM0222S
Concentration8,000 units/ml
Quantity500 units
ApplicationsFunctional Genomics
Brand/TrademarkNew England Biolabs Inc (NEB)
TypeEnzymes
Temperature-20 C

Specifications/Features

Unit Definition:
One unit is defined as the amount of enzyme required to protect 1 µg of lambda DNA in 1 hour at 37°C in a total reaction volume of 10 µl against cleavage by MboI restriction endonuclease.

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Fibertools: fast and accurate DNA-m6A calling using single-molecule long-read sequencingbioRxivJuly 12, 2023Anupama Jha, Stephanie C. Bohaczuk, Yizi Mao, Jane Ranchalis, Benjamin J. Mallory, Alan T. Min, Morgan O. Hamm, Elliott Swanson, Connor Finkbeiner, Tony Li, et al.(Invitrogen, cat#10977015). Taq methyltransferase (NEB, cat#M0219S), Dam methyltransferase (NEB, cat#M0222S), EcoRI methyltransferase (NEB, M0211S), ProNex® Size-Selective Chemistry (Promega, cat#NG2001), PacBio

(2) Dynamic chromosomal interactions and control of heterochromatin positioning by Ki‐67EMBO reportsDecember 6, 2022Tom van Schaik, Stefano G Manzo, Athanasios E Vouzas, Ning Qing Liu, Hans Teunissen, Elzo de Wit, David M Gilbert, Bas van Steenselprocessed without antibodies or pA‐Dam protein, but instead incubated with 4 units of Dam enzyme (NEB, M0222L) during the activating step. This freely diffusing Dam moiety serves as control to account for DNA accessibility

(3) CTCF and cohesin promote focal detachment of DNA from the nuclear laminaGenome biologySeptember 1, 2022van Schaik T, Liu NQ, Manzo SG, Peric-Hupkes D, de Wit E, van Steensel B.were processed in only DigWash and during Dam activation incubated with 4 units of Dam enzyme (NEB, M0222L). This Dam control sample serves to account for DNA accessibility and amplification biases. ATAC-seq ATAC-seq

(4) Impact of chromatin context on Cas9-induced DNA double-strand break repair pathway balanceMolecular cellMay 20, 2021Schep R, Brinkman EK, Leemans C, Vergara X, van der Weide RH, Morris B, van Schaik T, Manzo SG, Peric-Hupkes D, van den Berg J, et al.permeabilized cells (without any antibodies bound) were incubated with 4 units of Dam enzyme (NEB, M0222L) during the activation step. This sample functions as “dam-control” over which a log2-ratio is determined.

(5) Cell cycle dynamics of lamina‐associated DNA EMBO reportsNovember 5, 2020Tom van Schaik, Mabel Vos, Daan Peric‐Hupkes, Patrick HN Celie, Bas van Steenselwith 500 ng of unmethylated plasmid in 20 μl of 1× dam MethylTransferase buffer (New England BioLabs #M0222S) supplemented with 80 μM S‐adenosylmethionine (SAM) for 30 min at 37°C. As a positive control, a concentration

(6) No evidence for DNA N ⁶ -methyladenine in mammalsScience AdvancesMarch 20, 2020Karolos Douvlataniotis, Maike Bensberg, Antonio Lentini, Björn Gylemo, Colm E. Nestorand then scanned. Human 6mdA positive control DNA Using dA methylase (DAM) (New England Biolabs, M0222), a methyl group was added to the adenine (N6) in every 5′-GATC-3′ sequence. One microgram of DNA, 1×

(7) An Adversarial DNA N⁶-Methyladenine-Sensor Network Preserves Polycomb SilencingMolecular cellJune 20, 2019Kweon SM, Chen Y, Moon E, Kvederaviciutė K, Klimasauskas S, Feldman DE.Recombinant Proteins" ,, MG132,MilliporeSigma,Cat#M8699-1MG Dam methyltransferase,New England Biolabs,Cat#M0222S Power SYBR Green PCR Master Mix,ThermoFisher,Cat# 4367659 DNA Degradase Plus,Zymo Research,Cat#E2020 Mouse

(8) N⁶-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNAGenome biologyNovember 19, 2018Luo GZ, Hao Z, Luo L, Shen M, Sparvoli D, Zheng Y, Zhang Z, Weng X, Chen K, Cui Q, et al.GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCG(A)TCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In

(9) The mechanism of variability in transcription start site selectioneLifeNovember 23, 2017Libing Yu, Jared T Winkelman, Chirangini Pukhrambam, Terence R Strick, Bryce E Nickels, Richard H Ebrightbeta'R1148Bpa;D460A,this work,, "peptide, recombinant protein",Dam methyltransferase,New England BioLabs,Cat# M0222S, "peptide, recombinantprotein",restriction endonuclease SbfI-HF,New England BioLabs,Cat# R3642S, "peptide,

(10) Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegansBMC GenomicsDecember 1, 2010Ky Sha, Sam G Gu, Luiz C Pantalena-Filho, Amy Goh, Jamie Fleenor, Daniel Blanchard, Chaya Krishna, Andrew Fireμl (≈20-30 μg) N2 genomic DNA, 0.5 μl 32 mM S-adenosyl methionine, 1.0 μl E. coli DAM (8 U/μl, NEB M0222S), 20.0 μl 10× DAM buffer, 148.5 μl dH2O. Following one hour incubation at 37°C, the reaction was terminated

Be the First to Write a Review!