Q5 High-Fidelity 2X Master Mix from New England Biolabs

Product Specs
ItemQ5 High-Fidelity 2X Master Mix
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberM0492S
Quantity100 reactions
ApplicationsDNA Analysis
Brand/TrademarkNew England Biolabs Inc (NEB)
TypeMaster Mix
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Fucosylated glycoproteins and fucosylated glycolipids play opposing roles in cholera intoxicationbioRxivAugust 3, 2023Atossa C. Ghorashi, Andrew Boucher, Stephanie A. Archer-Hartmann, Nathan B. Murray, Rohit Sai Reddy Konada, Xunzhi Zhang, Chao Xing, Parastoo Azadi, Ulf Yrlid, Jennifer J. Kohleramino acid sequence. Amplification was done using the Q5 High-Fidelity 2X Master Mix (NEB, catalog no. M0492S) according to manufacturer’s instructions. Amplified ORFs were then purified using the MinElute PCR

(2) Characterisation of a Live-Attenuated Rabies Virus Expressing a Secreted scFv for the Treatment of RabiesVirusesJuly 31, 2023Samuel P. Smith, Rebecca Shipley, Pascal Drake, Anthony R. Fooks, Julian Ma, Ashley C. Banyard08-115)-coated T75 flasks. 2.2. Molecular Biology Techniques PCR was undertaken using NEB Q5® DNA Polymerase (M0492L) according to the manufacturer’s instructions and products isolated using either NEB Monarch® DNA Gel Extraction Kit

(3) Heterogeneous non-canonical nucleosomes predominate in yeast cells in situeLifeJuly 28, 2023Zhi Yang Tan, Shujun Cai, Alex J Noble, Jon K Chen, Jian Shi, Lu Ganat the restriction site5’-GATATC-3’ Other,Q5 High-Fidelity 2× Master Mix,New England BioLabs,Cat# M0492,"Contains Q5 DNA Polymerase, deoxynucleotides and Mg2+ in buffer, for PCR amplification" Other,Salmon

(4) Targeting AAV vectors to the central nervous system by engineering capsid–receptor interactions that enable crossing of the blood–brain barrierPLOS BiologyJuly 19, 2023Qin Huang, Albert T. Chen, Ken Y. Chan, Hikari Sorensen, Andrew J. Barry, Bahar Azari, Qingxia Zheng, Thomas Beddow, Binhui Zhao, Isabelle G. Tobey, et al.(CACTCATCGACCAATACTTGTACTATCTCT) as a forward primer in a PCR reaction using Q5 High-Fidelity 2X Master Mix (NEB #M0492S) following the manufacturer’s protocol for 30 cycles with 10 ng pUC57-wtAAV9-X/A plasmid. To assemble

(5) Pleiotropy of autism-associated chromatin regulatorsDevelopment (Cambridge, England)July 15, 2023Lasser M, Sun N, Xu Y, Wang S, Drake S, Law K, Gonzalez S, Wang B, Drury V, Castillo O, et al.individuals with ASD were created by site-directed mutagenesis using Q5 High Fidelity Master Mix (NEB M0492L), T4 polynucleotide kinase (NEB M0201L) and T4 DNA ligase (NEB M0202L). Variants were selected by presence

(6) Biochemical and structural characterization of the first-discovered metazoan DNA cytosine-N4 methyltransferase from the Bdelloid rotifer Adineta vagaJournal of Biological ChemistryJuly 5, 2023Jujun Zhou, John R. Horton, Gundeep Kaur, Qin Chen, Xuwen Li, Fabian Mendoza, Tao Wu, Robert M. Blumenthal, Xing Zhang, Xiaodong ChengMultiplex Oligos for Illumina (NEB, E7335S/E7500S/E7710S/E7730S) and Q5 High-Fidelity 2X Master Mix (NEB, M0492S) (cycle number was determined by qPCR with PowerUP SYBR Green Master Mix using R1-22nt (5′-CTA CAC GAC

(7) Assessment of enzymatically synthesized DNA for gene assemblyFrontiers in Bioengineering and BiotechnologyJuly 5, 2023Brooke L. Simmons, Nathan D. McDonald, Natalie G. Robinettincubated at 50°C/30 min. Next, 5 µL of this mixture was added to 12.5 µL of ×2 Q5 Master Mix (NEB, # M0492S), 2.5 µL each end oligo, and H2O to reach a final concentration of 25 µL. The PCR cycles were run as

(8) mRNA Delivery Platform Based on Bacterial Outer Membrane Vesicles for Tumor VaccineBio-protocolJuly 5, 2023Gao X, Li Y, Nie G, Zhao X.(New England Biolabs, catalog number: E2060S)Q5 high-fidelity 2× master mix (New England Biolabs, catalog number: M0492S)Tris-HCl (1 M, pH 8.0) (Solarbio, catalog number: T1150)MgCl2 (1 M) (Beyotime, catalog number: ST269)Diethylpyrocarbonate

(9) Aclarubicin stimulates RNA polymerase II elongation at closely spaced divergent promotersScience AdvancesJune 16, 2023Matthew Wooten, Brittany Takushi, Kami Ahmad, Steven Henikoffand a uniquely barcoded i7 primer and amplified with NEB Q5 high-fidelity 2× master mix (catalog no. M0492S). The libraries were purified with 1.1× volume of Sera-Mag carboxylate-modified magnetic beads and subjected

(10) Modularity and diversity of target selectors in Tn7 transposonsMolecular CellJune 15, 2023Guilhem Faure, Makoto Saito, Sean Benler, Iris Peng, Yuri I. Wolf, Jonathan Strecker, Han Altae-Tran, Edwin Neumann, David Li, Kira S. Makarova, et al.NEBNext® High-Fidelity 2X PCR Master Mix,New England Biolabs,M0541 Q5® High-Fidelity 2X Master Mix,New England Biolabs,M0492 KAPA HiFi HotStart ReadyMix,Roche,KK2602 KOD Hot Start DNA Polymerase,Millipore Sigma,71086-3 "E-Gel™ EX Agarose Gels, 1

(11) Group B Streptococcus Cas9 variants provide insight into programmable gene repression and CRISPR-Cas transcriptional effectsCommunications BiologyJune 9, 2023Kathyayini P. Gopalakrishna, Gideon H. Hillebrand, Venkata H. Bhavana, Jordan L. Elder, Adonis D’Mello, Hervé Tettelin, Thomas A. Hoovenensure silent mutations. Mutagenesis PCR was performed using NEB Q5 High Fidelity Polymerase (cat. #M0492L). PCR products were digested with 1 μL of DpnI for 1 h at 37 °C. Samples were then Gibson assembled

(12) Reduction of Tumor Growth with RNA-Targeting Treatment of the NAB2–STAT6 Fusion Transcript in Solitary Fibrous Tumor ModelsCancers (Basel)June 9, 2023Yi Li, John T. Nguyen, Manasvini Ammanamanchi, Zikun Zhou, Elijah F. Harbut, Jose L. Mondaza-Hernandez, Clark A. Meyer, David S. Moura, Javier Martin-Broto, Heather N. Hayenga, et al.performed using Q5 High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, WA, USA, catalog number: M0492). An amount of 100 ng genomic DNAs were used as the template, and the PCR conditions were: first, 1

(13) Muscleblind-like proteins use modular domains to localize RNAs by riding kinesins and docking to membranesNature communicationsJune 9, 2023Hildebrandt RP, Moss KR, Janusz-Kaminska A, Knudson LA, Denes LT, Saxena T, Boggupalli DP, Li Z, Lin K, Bassell GJ, et al.(cytosolic), and Calnexin (membrane) using qPCR primers (IDT) with Q5 polymerase (New England Biolabs, M0492) was measured with a highly sensitive dsDNA detection dye (Lumiprobe, 11010) on a 96-well RT-PCR thermal

(14) Pathogen-specific innate immune response patterns are distinctly affected by genetic diversityNature CommunicationsJune 5, 2023Antje Häder, Sascha Schäuble, Jan Gehlen, Nadja Thielemann, Benedikt C. Buerfent, Vitalia Schüller, Timo Hess, Thomas Wolf, Julia Schröder, Michael Weber, et al.ATCATTGAAATTAATTTCACCTGTCCA) with 2x Q5 polymerase master mix according to the manufacturer’s instructions (NEB Cat# M0492L). PCR samples were purified with the PCR & Gel Clean-Up Kit (Macherey-Nagel Cat# 740609.50) according

(15) Non-viral nitric oxide-based gene therapy improves perfusion and liposomal doxorubicin sonopermeation in neuroblastoma modelsTheranosticsJune 4, 2023Aditi Bellary, Chance Nowak, Isabella Iwanicki, Fernando Flores-Guzman, Lydia Wu, Jessica J. Kandel, Theodore W. Laetsch, Leonidas Bleris, Sonia L. Hernandez, Shashank R. Sirsiplasmid #19295) 43. The transcript was cloned using PCR with Q5® High-Fidelity DNA Polymerase (NEB, #M0492S) and primers P1: cagtagaccggtgagactctggccccacgggacacag and P2: cagtagcaattggaattgtaatacgactcactatagg.

(16) scChIX-seq infers dynamic relationships between histone modifications in single cellsNature BiotechnologyJune 1, 2023Jake Yeung, Maria Florescu, Peter Zeller, Buys Anton de Barbanson, Max D. Wellenstein, Alexander van Oudenaardenbarcodes and handles was performed by adding 25 μl of NEBNext Ultra II Q5 Master Mix (NEB, catalog no. M0492L), 11 μl nuclease-free water and 2 μl of 10 μM RP1 and RPIx primers. PCR protocol for sortChIC experiments Activation

(17) Identification and heterologous expression of the globomycin biosynthetic gene clusterSynthetic and Systems BiotechnologyJune 1, 2023Daniel Oves-Costales, Tetiana Gren, Eva Baggesgaard Sterndorff, Jesús Martín, Francisco Javier Ortiz-López, Tue S. Jørgensen, Xinglin Jiang, Fernando Román-Hurtado, Fernando Reyes, Olga Genilloud, et al.pL0004. The PCR reaction was carried out with the Q5 High Fidelity Master Mix (New England Biolabs; M0492S), following the manufacturer's instructions. The spores for colony PCR were harvested from plates using

(18) Protocol for biallelic tagging of an endogenous gene using CRISPR-Cas9 in human cellsSTAR ProtocolsJune 1, 2023Nannan Kong, Ying Wai Chan6023 DNeasy Blood & Tissue Kits,Qiagen,Cat# 69504 Q5 High-Fidelity 2× Master Mix,New England Biolabs,Cat# M0492L FastDigest Bpil,Thermo Fisher,Cat# FD1014 T7 DNA ligase,New England Biolabs,Cat# M0318S BamHI-HF,New England Biolabs

(19) A noncommutative combinatorial protein logic circuit controls cell orientation in nanoenvironmentsScience AdvancesMay 26, 2023Jiaxing Chen, Yashavantha L. Vishweshwaraiah, Richard B. Mailman, Erdem D. Tabdanov, Nikolay V. DokholyanLOV2. We performed all PCRs using Q5 High-Fidelity Master Mix [New England Biolabs (NEB), cat. no. M0492S]. After the reaction, we added DpnI (NEB, cat. no, R0176S) enzyme into the PCR mixture to digest the

(20) Reconstruction of a polyclonal ADCC antibody repertoire from an HIV-1 non-transmitting motheriScienceMay 19, 2023Zak A. Yaffe, Shilei Ding, Kevin Sung, Vrasha Chohan, Lorie Marchitto, Laura Doepker, Duncan Ralph, Ruth Nduati, Frederick A. Matsen, Andrés Finzi, et al.proteins","Chemicals, peptides, and recombinant proteins" ,, Q5 High-Fidelity MAster Mix,New England BioLabs,Cat#M0492S FreeStyle MAX,Thermo Fisher,Cat#16447500 Protein G agarose,Pierce,Cat#20397 293F FreeStyle Expression

Write a Review

(1)

8/6/2019PCR Master Mix for Superior Performance for a Broad Range of Amplicons (NEB) Atul SinghIt works well for all kinds of PCR.