BglII from New England Biolabs

Product Specs
ItemBglII
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberR0144S
Quantity2000 units
Concentration10 u/µL
ApplicationsDNA Manipulation
Brand/TrademarkNew England Biolabs Inc (NEB)
TypeRestriction Enzyme
Temperature-20 C

Sequence

A/GATCT

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Multiomic analysis of cohesin reveals that ZBTB transcription factors contribute to chromatin interactionsNucleic Acids ResearchJuly 21, 2023Rui Wang, Qiqin Xu, Chenlu Wang, Kai Tian, Hui Wang, Xiong Jilines. The plasmid pMK243 (Addgene, 72835) was digested by restriction enzymes BglII and MluI (NEB, R0144S and R0198S). The coding sequences of the target protein and the GFP open reading frame (ORF) were ligated

(2) Long-range DNA end resection supports homologous recombination by checkpoint activation rather than extensive homology generationeLifeJune 30, 2023Michael T Kimble, Matthew J Johnson, Mattie R Nester, Lorraine S Symingtonenzyme other,BamHI-HF,New England BioLabs,Cat# R3136S,Restriction enzyme other,BglII,New England BioLabs,Cat# R0144S,Restriction enzyme other,EcoRV-HF,New England BioLabs,Cat# R3195S,Restriction enzyme other,rCutSmart buffer

(3) Regulatory architecture of housekeeping genes is driven by promoter assembliesCell reportsMay 30, 2023Dejosez M, Dall'Agnese A, Ramamoorthy M, Platt J, Yin X, Hogan M, Brosh R, Weintraub AS, Hnisz D, Abraham BJ, et al.orientation, see Figure 5B), was generated by restriction of pTZ3023 (pSMaxFntbAS) with BglII (NEB, R0144S) and ApaI (NEB, R0114S). The 1.7 kb fragment was purified after gel electrophoresis with the Qiagen

(4) Transcription-Coupled Repair of DNA Interstrand Crosslinks by UVSSAbioRxivMay 13, 2023Rowyn Church Liebau, Crystal Waters, Arooba Ahmed, Rajesh K Soni, Jean Gautierall restriction enzymes acquired from NEB: BbsI (R0539S), BamHI (R0136S), NheI-(HF R3131S), BglII (R0144S), AscI (R0558S), EcoRI (R0101S)Kits: Q5 mutagenesis kit NEB (E0554S)Equipment: Attune NXT flow cytometer

(5) Next-generation plasmids for transgenesis in zebrafish and beyondDevelopmentApril 15, 2023Cassie L. Kemmler, Hannah R. Moran, Brooke F. Murray, Aaron Scoresby, John R. Klem, Rachel L. Eckert, Elizabeth Lepovsky, Sylvain Bertho, Susan Nieuwenhuize, Sibylle Burger, et al.E5520S). The original vector pDestTol2A2 (Tol2kit 394) (Kwan et al., 2007) was digested with BglII (NEB R0144S) and HpaI (NEB R0105S) restriction enzymes. The digested plasmid was purified using the Wizard SV Gel and PCR Clean-Up System

(6) Lysine Methyltransferase EhPKMT2 Is Involved in the In Vitro Virulence of Entamoeba histolyticaPathogensMarch 17, 2023Susana Munguía-Robledo, Esther Orozco, Guillermina García-Rivera, Jeni Bolaños, Jesús Valdés, Elisa Azuara-Licéaga, Mario Alberto Rodríguez(New England Biolabs, catalog no. R3189S, Ipswich, MA, USA) and BglII (New England Biolabs, catalog no. R0144S) and inserted (in antisense) into the pSA8 vector [17]. Transfection was carried out as described [18]

(7) Identification of exceptionally potent adenosine deaminases RNA editors from high body temperature organismsPLOS GeneticsMarch 6, 2023Adi Avram-Shperling, Eli Kopel, Itamar Twersky, Orshay Gabay, Amit Ben-David, Sarit Karako-Lampert, Joshua J. C. Rosenthal, Erez Y. Levanon, Eli Eisenberg, Shay Ben-Aroyadomains which were inserted into the pYES-DEST52-mdADAR1 digested with BglII (New England Biolabs, NEB- R0144S) by in-vivo homologous recombination in yeast. Protein extraction and immunoblotting analysis Logarithmically

(8) Prediction of designer-recombinases for DNA editing with generative deep learningNature CommunicationsDecember 27, 2022Lukas Theo Schmitt, Maciej Paszkowski-Rogacz, Florian Jug, Frank Buchholzproduce a PCR product from a pEVO plasmid. This fragment was then cloned into a BglII (NEB catalog number R0144S) digested pEVO plasmid using the Cold Fusion Cloning kit (System Biosciences catalog number MC010B-1).

(9) PIN-FORMED1 polarity in the plant shoot epidermis is insensitive to the polarity of neighboring cellsiScienceOctober 21, 2022Abdul Kareem, Neha Bhatia, Carolyn Ohno, Marcus G. HeislerPrimestar GXL DNA Polymerase,Takara,Cat#R050 In-Fusion,Takara,Cat#638911 SfiI,NEB,Cat#R0123S BamHI,NEB,Cat#R3136S BglII,NEB,Cat#R0144S LR clonase,Thermo Fisher,Cat#11791020 ,, Experimental models: Organisms/strains,Experimental models:

(10) CRISPR/Cas9-mediated tissue-specific knockout and cDNA rescue using sgRNAs that target exon-intron junctions in Drosophila melanogasterSTAR ProtocolsSeptember 16, 2022Madison Chilian, Karen Vargas Parra, Abigail Sandoval, Juan Ramirez, Wan Hee Yoon,New England Biolabs,Cat# R0189S EcoRI,New England Biolabs,Cat# R0101S BglII,New England Biolabs,Cat# R0144S OneTaq Hot Start 2× Master Mix with Standard Buffer,New England Biolabs,Cat# M0484S "BD Bacto Yeast Extract, Technical

(11) Deglutarylation of glutaryl-CoA dehydrogenase by deacylating enzyme SIRT5 promotes lysine oxidation in miceThe Journal of biological chemistryApril 1, 2022Bhatt DP, Mills CA, Anderson KA, Henriques BJ, Lucas TG, Francisco S, Liu J, Ilkayeva OR, Adams AE, Kulkarni SR, et al.was removed, and a FLAG sequence followed by a new STOP codon was introduced. A BglII (enzyme, NEB # R0144S) restriction site was added at the 3′ end for cloning it into the pSG5 vector using a reverse primer:

(12) Transcriptional Control of Trpm6 by the Nuclear Receptor FXRInternational Journal of Molecular SciencesFebruary 10, 2022Eun Young Kim, Jae Man LeeTranscription/Translation Systems (Cat.# L1170) from Promega (Chuo City, Tokyo); SacIHF (Cat.#R3156S) and BglII (Cat.# R0144S) from NEB (Ipswich, MA, USA); QuickChange Site-Directed Mutagenesis Kit (Cat.# 200519) from Agilent Technologies

(13) Single-cell-resolved dynamics of chromatin architecture delineate cell and regulatory states in zebrafish embryosCell GenomicsJanuary 12, 2022Alison C. McGarvey, Wolfgang Kopp, Dubravka Vučićević, Kenny Mattonet, Rieke Kempfer, Antje Hirsekorn, Ilija Bilić, Marine Gil, Alexandra Trinks, Anne Margarete Merks, et al.product was cloned into E1b-GFP-Tol283 (Addgene #37845) after digesting the plasmid with BglII (NEB, #R0144S) using Gibson Assembly Master Mix (NEB, #E2611L). The insert was confirmed with Sanger sequencing to

(14) Control of osteocyte dendrite formation by Sp7 and its target gene osteocrinNature CommunicationsDecember 1, 2021Jialiang S. Wang et al.(See sequence information in Supplementary Data 10). SacI and BglII restriction enzymes (NEB R0156S, R0144S) were used to cut both the pGL4 plasmid and the Ostn_En2 fragment. In all, 48 h later, cells were disassociated

(15) Glyoxalase-I Is Upregulated in Acute Cerulein-Induced Pancreatitis: A New Mechanism in Pancreatic Inflammation?Antioxidants (Basel)October 5, 2021Marcus Hollenbach, Sebastian Sonnenberg, Ines Sommerer, Jana Lorenz, Albrecht HoffmeisterCAGGAATTCCTAAATAATTGTTGCCATTTTGTT). The insert and a pEGFP-N1 vector (6085-1, Clontech, CA, USA) were digested by Bgl-II (R0144S, NEB, MA, USA) and EcoRI (R0101S, NEB). Dephosphorylation, ligation, transformation and midi preparation

(16) Analysis of Drosophila Atg8 proteins reveals multiple lipidation-independent rolesAutophagySeptember 2, 2021András Jipa, Viktor Vedelek, Zsolt Merényi, Adél Ürmösi, Szabolcs Takáts, Attila L. Kovács, Gábor V. Horváth, Rita Sinka, Gábor Juhászprimers, Atg8b 3ʹ-UTR with Atg8bUTRBGLIIFWD: AATTAGATCTCGCGGGCTTGACTCG and Atg8bUTRAcc65IREV: TAGAGGTACCAGCCGATCAGT pri mers and following XhoI (NEB, R0146S)-BglII (R0144S) and BglII (R0144S)-Acc65I (NEB, R0599S) double digestions, the purified fragments were ligated with

(17) METTL1-mediated m⁷G modification of Arg-TCT tRNA drives oncogenic transformationMolecular cellAugust 19, 2021Orellana EA, Liu Q, Yankova E, Pirouz M, De Braekeleer E, Zhang W, Lim J, Aspris D, Sendinc E, Garyfallos DA, et al."DAPI (4',6-Diamidino-2-Phenylindole, Dihydrochloride)",Invitrogen,Cat# D1306 XhoI,New England Biolabs,Cat# R0146S BglII,New England Biolabs,Cat# R0144S EcoRI,New England Biolabs,Cat# R0101S SalI,New England Biolabs,Cat# R0138S BamHI,New England Biolabs,Cat#

(18) Neuronal activity-induced BRG1 phosphorylation regulates enhancer activationCell reportsJuly 13, 2021Kim B, Luo Y, Zhan X, Zhang Z, Shi X, Yi J, Xuan Z, Wu J.Healthcare,Cat# GE17–5280-01 SacI,New England Biolabs,Cat# R0156S BgIII,New England Biolabs,Cat# R0144S NcoI,New England Biolabs,Cat# R0193S T4 DNA ligase,New England Biolabs,Cat# M0202S ,, Critical commercial

(19) In pancreatic β-cells myosin 1b regulates glucose-stimulated insulin secretion by modulating an early step in insulin granule trafficking from the GolgiMolecular Biology of the CellJune 1, 2021Hiroshi Tokuo, Shigeru Komaba, Lynne M. Coluccioobtained from New England Biolabs (Ipswich, MA). Restriction enzymes PmeI (R0560S), PacI (R0547S), BglII (R0144S), and XhoI (R0146S) were also obtained from New England Biolabs. Lipofectamine and Lipofectamine MAX

(20) Robo recruitment of the Wave regulatory complex plays an essential and conserved role in midline repulsioneLifeApril 12, 2021Chaudhari K, Gorla M, Chang C, Kania A, Bashaw GJ.drug",XbaI,New England Biolabs,Cat#R0145S, "Chemical compound, drug",BglII,New England Biolabs,Cat#R0144S, "Chemical compound, drug",XhoI,New England Biolabs,Cat#R0146S, "Chemical compound, drug",BbsI,New England Biolabs

Write a Review

(1)

4/24/2018Diagnostic Restriction Mapping Of Plasmid Construct With BglII Restriction Enzme Triveni MahendrappaI have constructed a plasmid called pCVD442_operon B of a size 18992 bp size. This plasmid was prepped from carrier E. coli strains and digested with BglII restriction enzyme from NEB. Restriction ... Read Review
(1)

10/2/2015High Quality Restriction Enzyme for Cloning Prabhakaran KumarI used this BglII restriction enzyme along with EcoRV for the cloning of my gene of interest into a plasmid vector. Subsequently, I also used this enzyme for colony screening. This enzyme completely ... Read Review

BglII

BglII from New England Biolabs

Sequence

New England Biolabs

Citations (48)

Reviews

BglII from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map